Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR4290 host gene URS000001E3A4_9606

  • 2,720 nucleotides
  • 7 databases (Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LNCipedia, NONCODE, RefSeq)
  • Found in 1 species
  • lncRNA

Automated summary: This lncRNA sequence is 2,720 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (RefSeq, LNCipedia, HGNC, Ensembl, Ensembl/GENCODE, NONCODE, GeneCards). Described in 5 papers. Homo sapiens (human) MIR4290 host gene sequence is a product of ENSG00000227555.1, NONHSAG052795.2, MIR4290HG genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUGUGGAAGCUUUGUCCUUGCAGUCUUCACAGUAAACCUUGCUACCACUCACUCUUUGGGUCUGUGCCAUCUUUAAGAGCUGUAACACUCACUGCGAAGGUCCACAGCUUUAUUCUUGAAGUCAGCGAGACCAUGAACCCACCGGCAGGAACUGACUCUGGACACAAUGGCGGCUCCUGACCAGACCCUCAGAACCUGAGGACGGGUGAUCAUUUCUGGUCCAGUGUCUUGACUGGCACCAAGUCAAGCAUUGUCCUCCACGUCAUCAGCUGCAGGCCAGAUAAUCUAAGAUGAUGCCAAACAGUCACUGCAGAAGAAUUUGCUGCACGGAGCUGUCUGGGAUGCCUCAGACCUGCCAGCGGUAGAGCUGCCUGCCUUGCUUCCUCUUGCUUACUCACAGCUCUAAGUCUGAACUUGGCUGCAGCUGUCCUGAACAGCCCAGGAGGAGCCUAGGCAGGAGGAGGCUUCUCUCCUAUGCAAUUUGGCUGAAUUUUAGUUACUCAAAAGAGCAAAGGAAGCACUUCUGAAUAUUCGUCAGGAGGAGCCAACCACCUUAGCUUGCUCCCUGAUGGGUUUUGUUCAGCCCCUGCCUUACUGUUGUCAGCCUGGACUGUCUUCUGGGCUUGGGUUCACCAUGUGUCUGGACCACGGGAGUGUCUCUAGGUGUCUCCCUUCCUGUGCAUUUCUCCUGGGCAUAGACACCCAUCCUGUGGAACACUGGGAGGAGGGUGCAAGACCCCACUGCACCCAGGCUUGGUUCCUCUUGGGUGCAGCAGCCUCAUCCCCUUGCAAGCCUUCCUCCCACUCCUCCCAGAAGGCUCUGCUUCCUCCACUUGCUCCUCUCCUAGGUGUGAGCCAGCAGGGUUUGGUCACCCAGAUAUGAAGUAUUAAUGUUGGACUCCUGUCUGGAGUCGGGAGUCUAUUAAGGAAGACGUGUGGGAGAGGCCUGUGUUCAAGGCCCUUAGAACCAUUCUGCCUGAGCCAUCAGCUCCUUAAAAAGAAAUCACCAAAGAUCCCAAACAAUGGCAGAGUCCCCCUCCCACCCUUUGGGCUACUUGGUAAAUAGGCCCACCAAUUCUAUCUCCAAAAUAUCUCCCAUCAGGACCAUGUGUAUAUUGACAUCUUUAUCUUCCAUCAGGUCAGGGUUGCCACAAAAGCCUCCAUCCAAAUUUCCUGAAAAAGCCCAGUUUCUCUAAAUGUGUGCAUGAACACGGUGCUGGGCAUGGCCCUCUCCUCUCAGUCCUUCUGCAACGCCCAGUGCCUUCACAGCCAAGGCCAGACUUCCUAGUGGAAGAGCAAAGUCCCUCCUGACACGGCUUCUGCUUGCAUCUGCAGCCCCACUUCCCCCACACCACGCUGCACCCUGAGCUCCUCACGGAGAGCCACCGUGUUUCACACCUGCCGUGCUCUGGGCCAGGUCGCUGGGCUUGCUGGUCCUUAGACUUGGAGCACCUGAUGCUGUUUGCCCAUCUGUGUCCUUGUCAGCCUUUGAGAAUUGGAUCUGGCAGCCCCUCCUCAGGAAGCCCAUGAGAGCCUCCGCCCCAUACUCACACAGACCCUGAGCUAGGUGGCCCCUGCCUGUGUCCCUCAGCUCCCAGCCCAGCUUCCAUGCAGCUUUAGCACAGUUUACCAGCACCAUCAAGACCCCUCUGGGAGGACAGAGAGCUCUGGGAGGACAGAGAGCUCUGAAGGACAGAACACGCAUGCCUUUCUGGUUGUUCCUCUGAAGCCUAGCACAACACUGACACGUGAGAAAUACUGGCUGAAUAAAAGGUGGAAGUGAAAAAGAACAACACUGACACGUGAGAAAUACUGGCUGAAUAAAAGGCACUGUGCAUUCCCUGCCCAUGAGGAAGGAAGCAGCUUAUUCCAUUUUCACCCCAGCAGAACCCCUGCAUGCAGGUUUAGGUCAACACUAGCUGCCAGCAGGAUGGAGACCCAGCAGCAUGCGGCACACGGGAGUCUCGCCGCGGGUCCUUGACAGAAGAGUAACGAGACUUUUCUUGAAAUAGUGUCCUGAGUUGAGAUCUGAGAAGAACCUGUUAUGCAUCCUAGAACACAGUGCAUUUGCAAGUCAUAAGAUGUUAGCACCGAUUAUGGAGCCUCGUGUGUUCUUAGGGGCUAUUUCCGUGACCUCGUCGGGGGUUCAAUGAGCAGCUUCAACAGAAAACUGGAUUUCCUUUUCCUCCAAGGCUGUCUUAUUUCCAGAUUACUCUGGACCUAAUUUUAAUCGUGCACACCUACCAUGGCAGGCUGUUUUCCUGUCCUCCCAAUGAUCUCCAUACAAUCUCACUGCUGGGUAGCACCUCCAUUCCCUUGCUUACCUAAGCCAUCAAAACCUGCAACAACUCACAAAACCACAAAAAGCAACAGAAAAUAUCAGAAGAUAAUCAAAUGAAUCAAGACCUCCAGAAAACUGUGCAUAAUUCAGUUUUCAUUUCAUUUAAUGAUAAUGUCCACAGUUAAUCAGGCAUUCCUUAUCAUUUGGAUCUACAUGUUGAAUAAACACAACAUCCCUAGACCUUUGAGGGUUUUCUAAAUAAUCUGCUGUUGAUUUUCUUAGGUACUGACCAGAUUACUAUGAAUAUUCCUGAUAGAAUAUGCUGACAAGAAACAAACAGGACAAGCCUAAAAUAGAGGUUCUGGUAAACAUUCAGGGAAAAGUUUAUUACUGACAUGUGAGAGCUCGGUUUUCAAGGUUAAUAAAAUAAAGUUGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.