Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-135b-5p URS000001C659_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCUUUUCAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-135b
  2. Canis lupus familiaris cfa-miR-135b
  3. Capra hircus (goat) chi-miR-135b-5p
  4. Cavia porcellus cpo-miR-135b-5p
  5. Dasypus novemcinctus dno-miR-135b-5p
  6. Echinops telfairi Ete-Mir-135-P4_5p (mature (guide))
  7. Equus caballus eca-miR-135b
  8. Gorilla gorilla gorilla ggo-miR-135b (MIR135B)
  9. Gorilla gorilla ggo-miR-135b
  10. Homo sapiens (human) hsa-miR-135b-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-135b-5p
  12. Monodelphis domestica Mdo-Mir-135-P4_5p (mature (guide))
  13. Mus musculus (house mouse) mmu-miR-135b-5p
  14. Pan troglodytes ptr-miR-135b
  15. Pongo pygmaeus ppy-miR-135b
  16. Rattus norvegicus (Norway rat) rno-miR-135b-5p
  17. Sarcophilus harrisii Sha-Mir-135-P4_5p (mature (guide))
  18. Tupaia chinensis tch-miR-135b-5p
Publications