Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-135b-5p URS000001C659_9925

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Capra hircus. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Capra hircus (goat) chi-miR-135b-5p sequence is a product of miR-135b, chi-miR-135b, miR-135, miR-135b-5p, chi-miR-135b-5p, MIR135B genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGGCUUUUCAUUCCUAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Bos taurus (cattle) bta-miR-135b
    2. Canis lupus familiaris cfa-miR-135b
    3. Cavia porcellus (domestic guinea pig) cpo-miR-135b-5p
    4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-135b-5p
    5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P1_5p (mature (guide))
    6. Equus caballus (horse) eca-miR-135b
    7. Gorilla gorilla (western gorilla) ggo-miR-135b
    8. Homo sapiens hsa-miR-135b-5p
    9. Macaca mulatta mml-miR-135b-5p
    10. Monodelphis domestica Mdo-Mir-135-P3_5p (mature (guide))
    11. Mus musculus (house mouse) mmu-miR-135b-5p
    12. Oryctolagus cuniculus (rabbit) ocu-miR-135b-5p
    13. Pan troglodytes (chimpanzee) ptr-miR-135b
    14. Pongo pygmaeus ppy-miR-135b
    15. Rattus norvegicus rno-miR-135b-5p
    16. Sarcophilus harrisii Sha-Mir-135-P3_5p (mature (guide))
    17. Tupaia chinensis tch-miR-135b-5p