Homo sapiens (human) hsa-miR-135b-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-135b-5p URS000001C659_9606

23 nucleotides
9 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, MirGeneDB, RefSeq, TarBase)
Found in 18 other species
1812 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-135b: Hsa-mir-135b is a microRNA that is up-regulated in TNP tumors and down-regulated in [PMC4206873]. The expression levels of miRNAs were assessed using Taqman Advanced miRNA assays, specifically hsa-mir-135b and cel-miR-39 [PMC8699528]. In a study involving MCF7 cells, hsa-mir-135b and hsa-miR-365-1 were transcribed in both control and E2-treated cells, but not in the MCF7-T groups [PMC2970572].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UAUGGCUUUUCAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.