Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-135b-5p URS000001C659_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, ENA, RefSeq, LncBase, IntAct, MirGeneDB, PSICQUIC, GeneCards, miRBase, MalaCards). Described in 60 papers. Homo sapiens (human) hsa-miR-135b-5p sequence is a product of miR-135b, hsa-miR-135b, miR-135, miR-135b-5p, hsa-miR-135b-5p, MIR135B genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 182-FIP, 3D3, 4.1-G, 4.1G, 82-FIP, A170, AA, AAC-11.

Interactions 8

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-135b-5p interacts with:

Interaction id Participant Synonyms
EBI-16876296 intact:EBI-16876248 EBI-16876248 ENST00000504921.6 mrna_mef2c
EBI-16878177 intact:EBI-16876406 EBI-16876406 ENST00000345097.8 mrna_foxn3
URS000001C659_9606-0 O00409 O00409
URS000001C659_9606-3 O00409 O00409
URS000001C659_9606-2 Q06413 Q06413
URS000001C659_9606-4 Q06413 Q06413
URS000001C659_9606-5 Q13362 Q13362
URS000001C659_9606-1 Q13362 Q13362

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGGCUUUUCAUUCCUAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Bos taurus (cattle) bta-miR-135b
    2. Canis lupus familiaris cfa-miR-135b
    3. Capra hircus chi-miR-135b-5p
    4. Cavia porcellus (domestic guinea pig) cpo-miR-135b-5p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-135b-5p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P1_5p (mature (guide))
    7. Equus caballus (horse) eca-miR-135b
    8. Gorilla gorilla (western gorilla) ggo-miR-135b
    9. Macaca mulatta mml-miR-135b-5p
    10. Monodelphis domestica Mdo-Mir-135-P3_5p (mature (guide))
    11. Mus musculus (house mouse) mmu-miR-135b-5p
    12. Oryctolagus cuniculus (rabbit) ocu-miR-135b-5p
    13. Pan troglodytes (chimpanzee) ptr-miR-135b
    14. Pongo pygmaeus ppy-miR-135b
    15. Rattus norvegicus rno-miR-135b-5p
    16. Sarcophilus harrisii Sha-Mir-135-P3_5p (mature (guide))
    17. Tupaia chinensis tch-miR-135b-5p