Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-135b URS000001C659_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCUUUUCAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-135b
  2. Canis lupus familiaris cfa-miR-135b
  3. Capra hircus (goat) chi-miR-135b-5p
  4. Cavia porcellus cpo-miR-135b-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-135b-5p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P4_5p (mature (guide))
  7. Equus caballus (horse) eca-miR-135b
  8. Gorilla gorilla gorilla ggo-miR-135b (MIR135B)
  9. Gorilla gorilla (western gorilla) ggo-miR-135b
  10. Homo sapiens (human) hsa-miR-135b-5p
  11. Macaca mulatta mml-miR-135b-5p
  12. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-135-P4_5p (mature (guide))
  13. Mus musculus mmu-miR-135b-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-135b-5p
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-135b
  16. Rattus norvegicus (Norway rat) rno-miR-135b-5p
  17. Sarcophilus harrisii Sha-Mir-135-P4_5p (mature (guide))
  18. Tupaia chinensis tch-miR-135b-5p
Publications