Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae (baker's yeast) tF(GAA)D secondary structure diagram

Saccharomyces cerevisiae (baker's yeast) tF(GAA)D URS000001C3AF_4932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGACUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAAAAAACUUUGGUCAAGAUAUCUGGAGGUCCUGUGUUCGAUCCACAGAGUUCGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Saccharomyces cerevisiae AWRI796 tRNA
  2. Saccharomyces cerevisiae FostersB tRNA
  3. Saccharomyces cerevisiae FostersO tRNA
  4. Saccharomyces cerevisiae P301 tRNA-Phe
  5. Saccharomyces cerevisiae R008 tRNA-Phe
  6. Saccharomyces cerevisiae R103 tRNA-Phe
  7. Saccharomyces cerevisiae RM11-1a tRNA-Phe
  8. Saccharomyces cerevisiae S288C tRNA-Phe
  9. Saccharomyces cerevisiae VL3 tRNA
  10. Saccharomyces pastorianus tRNA-Phe
2D structure