Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Fibrella aestuarina BUZ 2 5S ribosomal RNA secondary structure diagram

Fibrella aestuarina BUZ 2 5S ribosomal RNA URS000001B194_1166018

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUAACGACGGGCGGGUGAACACCUUUUCCCAUUCCGAACAGAGCCGUUAAGCCCCGCACUGCCGAUGGUACUGGAGUCGAAUCCGGGAGAGUAGGCGGUCGCCACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Fibrella aestuarina 5S rRNA
2D structure