Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-205 precursor URS0000016914_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR205: MIR205, a type of microRNA, has been found to reduce the expression of various markers associated with the epithelial-mesenchymal process, including CD44, TAZ, E2A.E12, Twist, Snail-1, and mesenchymal CK5 [PMC5705145]. One of the target genes of MIR205 is PRKCE [PMC4052696]. Additionally, MIR205 has been identified alongside other microRNAs such as miR488*, miR125, mir185, miR1 and miR31 [PMC4742123]. Furthermore, a study found that MIR205 is among a group of microRNAs that can predict the presence of a tumor with an AUC value of 0.85 [PMC4815774].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications