Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-205 precursor URS0000016914_9597

• 110 nucleotides
• 4 databases (ENA, Ensembl, miRBase, RefSeq)
• Found in 7 other species
• 216 publications
• 1. transcript
  2. pre-miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

1. Gorilla gorilla gorilla ggo-mir-205 (ENSGGOG00000034434.2)
2. Gorilla gorilla (western gorilla) microRNA ggo-mir-205 precursor
3. Homo sapiens microRNA hsa-mir-205 precursor
4. Pan troglodytes microRNA ptr-mir-205 precursor

Publications Download

• FASTA
• JSON