v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7a-2-3p URS00000157F5_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGUACAGCCUCCUAGCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Alligator mississippiensis (American alligator) ami-let-7c-2-3p
  2. Anolis carolinensis aca-let-7c-2-3p
  3. Cavia porcellus cpo-let-7a-2-3p
  4. Chrysemys picta (Painted turtle) cpi-let-7c-2-3p
  5. Cricetulus griseus cgr-let-7a-2
  6. Dasypus novemcinctus dno-let-7c-2-3p
  7. Macaca mulatta mml-let-7a-2-3p
  8. Monodelphis domestica mdo-let-7a-3p
  9. Ophiophagus hannah oha-let-7c-1-3p
  10. Pteropus alecto (black flying fox) pal-let-7a-2-3p
  11. Rattus norvegicus rno-let-7a-2-3p
  12. Salmo salar ssa-let-7a-3p
 Publications