Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-let-7a-2-3p URS00000157F5_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUACAGCCUCCUAGCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Alligator mississippiensis ami-let-7c-2-3p
  2. Anolis carolinensis aca-let-7c-2-3p
  3. Cavia porcellus (domestic guinea pig) cpo-let-7a-2-3p
  4. Chrysemys picta cpi-let-7c-2-3p
  5. Cricetulus griseus (Chinese hamster) cgr-let-7a-2
  6. Dasypus novemcinctus dno-let-7c-2-3p
  7. Homo sapiens hsa-let-7a-2-3p
  8. Monodelphis domestica mdo-let-7a-3p
  9. Ophiophagus hannah (king cobra) oha-let-7c-1-3p
  10. Pteropus alecto pal-let-7a-2-3p
  11. Rattus norvegicus rno-let-7a-2-3p
  12. Salmo salar ssa-let-7a-3p
Publications