Dasypus novemcinctus (nine-banded armadillo) dno-let-7c-2-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-let-7c-2-3p URS00000157F5_9361

22 nucleotides
1 database (miRBase)
Found in 12 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUGUACAGCCUCCUAGCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Alligator mississippiensis (American alligator) ami-let-7c-2-3p
Anolis carolinensis aca-let-7c-2-3p
Cavia porcellus cpo-let-7a-2-3p
Chrysemys picta (Painted turtle) cpi-let-7c-2-3p
Cricetulus griseus cgr-let-7a-2
Homo sapiens hsa-let-7a-2-3p
Macaca mulatta mml-let-7a-2-3p
Monodelphis domestica mdo-let-7a-3p
Ophiophagus hannah oha-let-7c-1-3p
Pteropus alecto (black flying fox) pal-let-7a-2-3p
Rattus norvegicus rno-let-7a-2-3p
Salmo salar ssa-let-7a-3p