Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Microcebus murinus (gray mouse lemur) small nucleolar RNA, H/ACA box 50A (ENSMICG00000047422.1) secondary structure diagram

Microcebus murinus (gray mouse lemur) small nucleolar RNA, H/ACA box 50A (ENSMICG00000047422.1) URS0000013F57_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCACUGCCUUUGAACCUGAUGUGUCUUGUUUGUAGCUUCACGGGCCAAGCAACAGUGCUAGAGCAUAACGACUUGUUAUAACUGGGGCUCUUCAGCUCUCAACUGAACUGCUCUUUUAAAAACAAGGUACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aotus nancymaae snoRNA (ENSANAG00000007617.1)
  2. Carlito syrichta snoRNA (ENSTSYG00000031917.1)
  3. Cebus imitator small nucleolar RNA, H/ACA box 50A (ENSCCAG00000004735.1)
  4. Cercocebus atys snoRNA (ENSCATG00000020581.1)
  5. Chlorocebus sabaeus small nucleolar RNA, H/ACA box 50A (ENSCSAG00000024117.1)
  6. Colobus angolensis palliatus (Angola colobus) snoRNA (ENSCANG00000001493.1)
  7. Gorilla gorilla gorilla small nucleolar RNA, H/ACA box 50A (ENSGGOG00000044047.1)
  8. Homo sapiens small nucleolar RNA, H/ACA box 50A (SNORA50A)
  9. Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, H/ACA box 50A (ENSMFAG00000017889.2)
  10. Macaca mulatta small nucleolar RNA, H/ACA box 50A (ENSMMUG00000025577.3)
  11. Macaca nemestrina snoRNA (ENSMNEG00000014632.1)
  12. Mandrillus leucophaeus (Drill) snoRNA (ENSMLEG00000006078.1)
  13. Nomascus leucogenys small nucleolar RNA, H/ACA box 50A (ENSNLEG00000035265.1)
  14. Pan paniscus small nucleolar RNA, H/ACA box 50A (ENSPPAG00000011379.1)
  15. Pan troglodytes small nucleolar RNA, H/ACA box 50A (ENSPTRG00000025867.3)
  16. Papio anubis snoRNA (ENSPANG00000038112.1)
  17. Piliocolobus tephrosceles small nucleolar RNA, H/ACA box 50A (ENSPTEG00000027234.1)
  18. Pongo abelii (Sumatran orangutan) snoRNA (ENSPPYG00000032028.1)
  19. Propithecus coquereli (Coquerel's sifaka) snoRNA (ENSPCOG00000011631.1)
  20. Rhinopithecus bieti snoRNA (ENSRBIG00000007277.1)
  21. Rhinopithecus roxellana (Golden snub-nosed monkey) small nucleolar RNA, H/ACA box 50A (ENSRROG00000008176.1)
  22. Theropithecus gelada small nucleolar RNA SNORA50 (ENSTGEG00000002961.1)
2D structure Publications