Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Capra hircus (goat) microRNA chi-mir-21 precursor secondary structure diagram

Capra hircus (goat) microRNA chi-mir-21 precursor URS0000013967_9925

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Capra hircus. Annotated by 3 databases (Ensembl, miRBase, RefSeq). Described in 4 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-21, RF00658). Capra hircus (goat) microRNA chi-mir-21 precursor sequence is a product of 21, MIR21, ENSCHIG00010018649.1, mir-21 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Ailuropoda melanoleuca microRNA 21 (ENSAMEG00000021813.2)
    2. Balaenoptera musculus miRNA (ENSBMSG00010019818.1)
    3. Bison bison bison (American bison) miRNA (ENSBBBG00000008444.1)
    4. Bos grunniens microRNA 21 (ENSBGRG00000021122.1)
    5. Bos indicus x Bos taurus microRNA 21 (ENSBIXG00000009322.1, ENSBIXG00005024807.1)
    6. Bos mutus (wild yak) microRNA 21 (ENSBMUG00000004870.1)
    7. Bos taurus (cattle) miRNA (ENSBTAG00000029897.2)
    8. Camelus dromedarius microRNA 21 (ENSCDRG00005005060.1)
    9. Canis lupus dingo microRNA 21 (ENSCAFG00020026507.1)
    10. Canis lupus familiaris miRNA (ENSCAFG00000020471.1, ENSCAFG00030004641.1, ENSCAFG00040001500.1)
    11. Catagonus wagneri microRNA 21 (ENSCWAG00000015264.1)
    12. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000000415.1)
    13. Cricetulus griseus microRNA cgr-mir-21 precursor
    14. Delphinapterus leucas (beluga whale) microRNA 21 (ENSDLEG00000007389.1)
    15. Dipodomys ordii miRNA (ENSDORG00000022126.2)
    16. Equus asinus asinus microRNA 21 (ENSEASG00005002299.1)
    17. Equus caballus (horse) miRNA (ENSECAG00000025574.2)
    18. Mesocricetus auratus miRNA (ENSMAUG00000002742.1)
    19. Microtus ochrogaster (vole) microRNA 21a (ENSMOCG00000007742.1)
    20. Monodon monoceros (narwhal) miRNA (ENSMMNG00015018634.1)
    21. Moschus moschiferus microRNA 21 (ENSMMSG00000017439.1)
    22. Nannospalax galili miRNA (ENSNGAG00000001811.1)
    23. Otolemur garnettii miRNA (ENSOGAG00000017260.1)
    24. Phocoena sinus miRNA (ENSPSNG00000014625.1)
    25. Physeter catodon (sperm whale) microRNA 21 (ENSPCTG00005021116.1)
    26. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000013084.1)
    27. Pteropus vampyrus miRNA (ENSPVAG00000026322.1)
    28. Rattus norvegicus microRNA rno-mir-21 precursor
    29. Rhinolophus ferrumequinum microRNA 21 (ENSRFEG00010010196.1)
    30. Sus scrofa (pig) microRNA ssc-mir-21 precursor
    31. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017959.1)
    32. Tursiops truncatus miRNA (ENSTTRG00000023376.1)
    33. Ursus americanus miRNA (ENSUAMG00000016572.1)
    34. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000022707.1)
    35. Ursus thibetanus thibetanus microRNA 21 (ENSUTTG00000022123.1)
    36. Vicugna pacos (alpaca) miRNA (ENSVPAG00000017008.1)
    37. Vulpes vulpes (red fox) microRNA 21 (ENSVVUG00000018133.1)
    38. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015022219.1)
    2D structure New