Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-21 precursor URS0000013967_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-21: Ssc-mir-21 is a microRNA that directly regulates endogenous TGFβI protein synthesis during myogenesis, as concluded from in vivo and in vitro experiments [PMC4423774]. In a study, different classes of microRNAs were analyzed for their expression levels at different developmental stages [PMC4423774]. One class, including ssc-mir-21, showed 100-fold greater expression at E90 compared to D100 [PMC4423774]. Other microRNAs in this class were ssc-miR-126, ssc-miR-143-3p, ssc-miR-127, ssc-miR-148a, ssc-miR-196b-5p, and ssc-miR-369 [PMC4423774]. Another class of microRNAs exhibited expression levels slightly lower than 100-fold compared to D100 [PMC4423774]. This class included ssc-miR-542-3p, ssc-miR-99b, ssc-miR-378, ssc-miR-30a-5p, ssc-miR-10b, and ssc-mir-21 [PMC4423774]. These findings provide insights into the differential expression patterns of various microRNAs during myogenesis and highlight the role of specific microRNAs like ssc-mir-21 in regulating protein synthesis [PMC4423774].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Ailuropoda melanoleuca (giant panda) microRNA 21 (ENSAMEG00000021813.2)
  2. Balaenoptera musculus (Blue whale) microRNA 21 (ENSBMSG00010019818.1)
  3. Bison bison bison miRNA (ENSBBBG00000008444.1)
  4. Bos grunniens microRNA 21 (ENSBGRG00000021122.1)
  5. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000009322.1, ENSBIXG00005024807.1)
  6. Bos mutus (wild yak) microRNA 21 (ENSBMUG00000004870.1)
  7. Bos taurus (cattle) microRNA 21 (ENSBTAG00000029897.2)
  8. Camelus dromedarius (Arabian camel) microRNA 21 (ENSCDRG00005005060.1)
  9. Canis lupus dingo (dingo) microRNA 21 (ENSCAFG00020026507.1)
  10. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020471.2, ENSCAFG00030004641.1, ENSCAFG00040001500.1, ENSCAFG00845025927.1)
  11. Capra hircus microRNA chi-mir-21 precursor
  12. Catagonus wagneri (Chacoan peccary) microRNA 21 (ENSCWAG00000015264.1)
  13. Cervus hanglu yarkandensis microRNA 21 (ENSCHYG00000000415.1)
  14. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-21 precursor
  15. Delphinapterus leucas (beluga whale) microRNA 21 (ENSDLEG00000007389.1)
  16. Dipodomys ordii (Ord's kangaroo rat) miRNA (ENSDORG00000022126.2)
  17. Equus asinus asinus (donkey) microRNA 21 (ENSEASG00005002299.1)
  18. Equus asinus (ass) microRNA 21 (ENSEASG00005002299.2)
  19. Equus caballus (horse) microRNA 21 (ENSECAG00000025574.2)
  20. Mesocricetus auratus miRNA (ENSMAUG00000002742.1)
  21. Microtus ochrogaster microRNA 21a (ENSMOCG00000007742.1)
  22. Monodon monoceros microRNA 21 (ENSMMNG00015018634.1)
  23. Moschus moschiferus (Siberian musk deer) microRNA 21 (ENSMMSG00000017439.1)
  24. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000001811.1)
  25. Otolemur garnettii miRNA (ENSOGAG00000017260.1)
  26. Phocoena sinus microRNA 21 (ENSPSNG00000014625.1)
  27. Physeter catodon microRNA 21 (ENSPCTG00005021116.1)
  28. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000013084.1)
  29. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000026322.1)
  30. Rattus norvegicus microRNA rno-mir-21 precursor
  31. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 21 (ENSRFEG00010010196.1)
  32. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017959.1)
  33. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000023376.1)
  34. Ursus americanus (American black bear) miRNA (ENSUAMG00000016572.1)
  35. Ursus maritimus miRNA (ENSUMAG00000022707.1)
  36. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 21 (ENSUTTG00000022123.1)
  37. Vicugna pacos miRNA (ENSVPAG00000017008.1)
  38. Vulpes vulpes microRNA 21 (ENSVVUG00000018133.1)
  39. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015022219.1)
Publications