Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-21 precursor URS0000013967_9823

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Sus scrofa. Annotated by 4 databases (miRBase, ENA, Ensembl, RefSeq). Matches 1 Rfam family (mir-21, RF00658). Sus scrofa (pig) microRNA ssc-mir-21 precursor sequence is a product of ENSSSCG00070003524.1, ENSSSCG00065061590.1, ENSSSCG00015008464.1, ENSSSCG00060075530.1, 21, MIR21, ENSSSCG00025035783.1, ENSSSCG00045005506.1, ENSSSCG00040022643.1, ENSSSCG00050073051.1, ENSSSCG00005010701.1, ENSSSCG00030017459.1, ENSSSCG00055026339.1, ENSSSCG00035055655.1, ENSSSCG00000018555.2, mir-21 genes. Found in the pig reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 21 (ENSAMEG00000021813.2)
    2. Balaenoptera musculus microRNA 21 (ENSBMSG00010019818.1)
    3. Bison bison bison miRNA (ENSBBBG00000008444.1)
    4. Bos grunniens (domestic yak) microRNA 21 (ENSBGRG00000021122.1)
    5. Bos indicus x Bos taurus (hybrid cattle) microRNA 21 (ENSBIXG00000009322.1, ENSBIXG00005024807.1)
    6. Bos mutus microRNA 21 (ENSBMUG00000004870.1)
    7. Bos taurus (cattle) microRNA 21 (ENSBTAG00000029897.2)
    8. Camelus dromedarius microRNA 21 (ENSCDRG00005005060.1)
    9. Canis lupus dingo (dingo) microRNA 21 (ENSCAFG00020026507.1)
    10. Canis lupus familiaris miRNA (ENSCAFG00000020471.2, ENSCAFG00030004641.1, ENSCAFG00040001500.1, ENSCAFG00845025927.1)
    11. Capra hircus microRNA chi-mir-21 precursor
    12. Catagonus wagneri microRNA 21 (ENSCWAG00000015264.1)
    13. Cervus hanglu yarkandensis (Yarkand deer) microRNA 21 (ENSCHYG00000000415.1)
    14. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-21 precursor
    15. Delphinapterus leucas microRNA 21 (ENSDLEG00000007389.1)
    16. Dipodomys ordii (Ord's kangaroo rat) miRNA (ENSDORG00000022126.2)
    17. Equus asinus asinus microRNA 21 (ENSEASG00005002299.1)
    18. Equus caballus (horse) microRNA 21 (ENSECAG00000025574.2)
    19. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000002742.1)
    20. Microtus ochrogaster (vole) microRNA 21a (ENSMOCG00000007742.1)
    21. Monodon monoceros (narwhal) microRNA 21 (ENSMMNG00015018634.1)
    22. Moschus moschiferus (Siberian musk deer) microRNA 21 (ENSMMSG00000017439.1)
    23. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000001811.1)
    24. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017260.1)
    25. Phocoena sinus microRNA 21 (ENSPSNG00000014625.1)
    26. Physeter catodon microRNA 21 (ENSPCTG00005021116.1)
    27. Prolemur simus miRNA (ENSPSMG00000013084.1)
    28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000026322.1)
    29. Rattus norvegicus microRNA rno-mir-21 precursor
    30. Rhinolophus ferrumequinum microRNA 21 (ENSRFEG00010010196.1)
    31. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017959.1)
    32. Tursiops truncatus miRNA (ENSTTRG00000023376.1)
    33. Ursus americanus (American black bear) miRNA (ENSUAMG00000016572.1)
    34. Ursus maritimus miRNA (ENSUMAG00000022707.1)
    35. Ursus thibetanus thibetanus microRNA 21 (ENSUTTG00000022123.1)
    36. Vicugna pacos (alpaca) miRNA (ENSVPAG00000017008.1)
    37. Vulpes vulpes microRNA 21 (ENSVVUG00000018133.1)
    38. Zalophus californianus miRNA (ENSZCAG00015022219.1)
    Publications New