Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-21 precursor URS0000013967_10116

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (Ensembl, miRBase, RGD, RefSeq). Matches 1 Rfam family (mir-21, RF00658). Rattus norvegicus (Norway rat) microRNA rno-mir-21 precursor sequence is a product of ENSRNOG00000035480.2, Mir21 genes. Found in the norway rat reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 168 other species

    1. Ailuropoda melanoleuca microRNA 21 (ENSAMEG00000021813.2)
    2. Balaenoptera musculus (Blue whale) miRNA MIR21 (ENSBMSG00010019818.1)
    3. Bison bison bison (American bison) miRNA (ENSBBBG00000008444.1)
    4. Bos grunniens microRNA 21 (ENSBGRG00000021122.1)
    5. Bos indicus x Bos taurus (hybrid cattle) microRNA 21 (ENSBIXG00000009322.1, ENSBIXG00005024807.1)
    6. Bos mutus microRNA 21 (ENSBMUG00000004870.1)
    7. Bos taurus (cattle) miRNA MIR21 (ENSBTAG00000029897.2)
    8. Camelus dromedarius (Arabian camel) microRNA 21 (ENSCDRG00005005060.1)
    9. Canis lupus dingo microRNA 21 (ENSCAFG00020026507.1)
    10. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020471.2, ENSCAFG00030004641.1, ENSCAFG00040001500.1, ENSCAFG00845025927.1)
    11. Capra hircus microRNA chi-mir-21 precursor
    12. Catagonus wagneri (Chacoan peccary) microRNA 21 (ENSCWAG00000015264.1)
    13. Cervus hanglu yarkandensis miRNA MIR21 (ENSCHYG00000000415.1)
    14. Cricetulus griseus microRNA cgr-mir-21 precursor
    15. Delphinapterus leucas (beluga whale) microRNA 21 (ENSDLEG00000007389.1)
    16. Dipodomys ordii miRNA (ENSDORG00000022126.2)
    17. Equus asinus asinus microRNA 21 (ENSEASG00005002299.1)
    18. Equus caballus microRNA 21 (ENSECAG00000025574.2)
    19. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000002742.1)
    20. Microtus ochrogaster (vole) microRNA 21a (ENSMOCG00000007742.1)
    21. Monodon monoceros (narwhal) microRNA 21 (ENSMMNG00015018634.1)
    22. Moschus moschiferus microRNA 21 (ENSMMSG00000017439.1)
    23. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000001811.1)
    24. Otolemur garnettii miRNA (ENSOGAG00000017260.1)
    25. Phocoena sinus miRNA (ENSPSNG00000014625.1)
    26. Physeter catodon (sperm whale) microRNA 21 (ENSPCTG00005021116.1)
    27. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000013084.1)
    28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000026322.1)
    29. Rhinolophus ferrumequinum microRNA 21 (ENSRFEG00010010196.1)
    30. Sus scrofa microRNA ssc-mir-21 precursor
    31. Tupaia belangeri miRNA (ENSTBEG00000017959.1)
    32. Tursiops truncatus miRNA (ENSTTRG00000023376.1)
    33. Ursus americanus (American black bear) miRNA (ENSUAMG00000016572.1)
    34. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000022707.1)
    35. Ursus thibetanus thibetanus microRNA 21 (ENSUTTG00000022123.1)
    36. Vicugna pacos miRNA (ENSVPAG00000017008.1)
    37. Vulpes vulpes (red fox) microRNA 21 (ENSVVUG00000018133.1)
    38. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015022219.1)
    Publications New