Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-212 URS0000012002_8364

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Xenopus tropicalis. Annotated by 2 databases (RefSeq, miRBase). Xenopus tropicalis (tropical clawed frog) xtr-miR-212 sequence is a product of xtr-miR-212, mir212, miR-212 genes. Found in the tropical clawed frog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAACAGUCUACAGUCAUGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Callorhinchus milii (elephant shark) eshark_mir-132_1
    2. Danio rerio (zebrafish) dre-miR-212
    3. Gadus morhua gmo-miR-212-3p
    4. Gallus gallus (chicken) gga-miR-212-3p
    5. Gekko japonicus Gja-Mir-132-P2_3p (mature (co-guide))
    6. Maylandia zebra (zebra mbuna) mze-miR-212a
    7. Oreochromis niloticus (Nile tilapia) oni-miR-212b
    8. Pundamilia nyererei pny-miR-212
    9. Salmo salar (Atlantic salmon) ssa-miR-212a-3p
    10. Takifugu rubripes (torafugu) fru-miR-212
    11. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-212
    12. Tor tambroides miR-212
    Publications New