Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-503-3p URS0000011312_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-503: Mmu-mir-503 is a type of microRNA that has been studied in various contexts. In a study on lung development, it was found that mmu-mir-503, along with mmu-mir-19a, plays a role in determining the different functions of Prdx6 at different stages of lung development [PMC3866260]. Mmu-mir-503 is also part of a cluster of miRNAs on the mouse X-chromosome, along with mmu-miR-351, mmu-mir-503*, and mmu-miR-542-5p [PMC3477035]. However, it was found that using a commercial kit, mmu-mir-503 was not detected by qRT-PCR analysis [PMC3477035]. To overcome this issue and detect mmu-mir-503, the recommended protocol of the commercial detection kit was not modified [PMC3477035]. Mmu-mir-503 has also been identified as one of the highly expressed miRNAs in placental tissue [PMC6366741]. Overall, these studies highlight the importance and involvement of mmu-mir-503 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGUAUUGUUUCCACUGCCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications