v19

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) snoRNA:Psi18S-640f (Dmel_CR34583) URS0000010B2C_7227

Automated summary: This snoRNA sequence is 126 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, FlyBase, snOPY, RefSeq). Described in 13 papers. Drosophila melanogaster (fruit fly) snoRNA:Psi18S-640f (Dmel_CR34583) sequence is a product of snoRNA:Psi18S-640f, Psi18S-640f, psi18s-640f snoRNA, FBgn0083021 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    GUGGAGACAAAGUUUACAUUUUAACAGUAUUAUCGUUUUUAUGUCUACAAUGCUCCGAAAUCAAUAUCCGAUCCAAUUAUCCAAAGCAGUCUUAUAUUUCCUUGGAUGAUUUCUUUCGUUACAAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.