Automated summary: This snoRNA sequence is 126 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (snOPY, FlyBase, ENA, RefSeq). Described in 13 papers. Drosophila melanogaster (fruit fly) snoRNA:Psi18S-640f (Dmel_CR34583) sequence is a product of Psi18S-640f, psi18s-640f snoRNA, snoRNA:Psi18S-640f, FBgn0083021 genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUGGAGACAAAGUUUACAUUUUAACAGUAUUAUCGUUUUUAUGUCUACAAUGCUCCGAAAUCAAUAUCCGAUCCAAUUAUCCAAAGCAGUCUUAUAUUUCCUUGGAUGAUUUCUUUCGUUACAAAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.