Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycoplasma pneumoniae M129 5S ribosomal RNA secondary structure diagram

Mycoplasma pneumoniae M129 5S ribosomal RNA URS000000E851_272634

Automated summary: This rRNA sequence is 108 nucleotides long and is found in Mycoplasma pneumoniae M129. Annotated by 3 databases (ENA, Rfam, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUUGGUGCCCAUGUCGCUGUGGAAACACCUGGUUCCAUUUCGAACCCAGCAGUUAAGCACAGUGGAGCCGAAUGUAGCUGUUUCAGUGAGAAUAGGAAAGCACCAAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Mycoplasma pneumoniae 19294 5S ribosomal RNA
    2. Mycoplasma pneumoniae 309 5S ribosomal RNA
    3. Mycoplasma pneumoniae 39443 5S ribosomal RNA
    4. Mycoplasma pneumoniae 51494 5S ribosomal RNA
    5. Mycoplasma pneumoniae 54089 5S ribosomal RNA
    6. Mycoplasma pneumoniae 54524 5S ribosomal RNA
    7. Mycoplasma pneumoniae 5S rRNA
    8. Mycoplasma pneumoniae 85084 5S ribosomal RNA
    9. Mycoplasma pneumoniae 85138 5S ribosomal RNA
    10. Mycoplasma pneumoniae FH 5S ribosomal RNA
    11. Mycoplasma pneumoniae M1139 5S ribosomal RNA
    12. Mycoplasma pneumoniae M129-B7 5S ribosomal RNA
    13. Mycoplasma pneumoniae M2592 5S ribosomal RNA
    14. Mycoplasma pneumoniae MAC 5S ribosomal RNA
    15. Mycoplasma pneumoniae PI 1428 5S ribosomal RNA
    16. Mycoplasma pneumoniae PO1 5S ribosomal RNA
    2D structure