Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Haliscomenobacter hydrossis DSM 1100 5S ribosomal RNA secondary structure diagram

Haliscomenobacter hydrossis DSM 1100 5S ribosomal RNA URS000000E4C5_760192

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGGUGGUUAUAGCGAGCGGGUUCCACCUCUUCCCAUUCCGAACAGAGAAGUUAAGCCGCUCAGCGCUGAUGGUACUGCCCUUGGGUGGGAGAGUAGGUCGCUGCCAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Haliscomenobacter hydrossis 5S rRNA
  2. Haliscomenobacter sp. (activated sludge metagenome) 5S ribosomal RNA
2D structure Publications