Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-26a-5p URS000000E09E_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 8 papers. Gallus gallus (chicken) gga-miR-26a-5p sequence is a product of miR-26a-5p, miR-26a, MIR26A1, gga-miR-26a-5p, miR-26, gga-miR-26a genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCAAGUAAUCCAGGAUAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Bos taurus (cattle) microRNA miR-26a
    2. Capra hircus miR-26a
    3. Hippoglossus hippoglossus hhi-miR-26
    4. Monodelphis domestica mdo-miR-26-5p
    5. Mus musculus Mus_musculus piRNA piR-mmu-72537
    6. Oryzias latipes (Japanese medaka) ola-miR-26
    7. Ovis aries miscellaneous RNA
    8. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63023
    9. Tursiops truncatus (common bottlenose dolphin) miR-26a
    10. Xenopus tropicalis (tropical clawed frog) xtr-miR-26