Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 115-15 (SNORD115-15) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 115-15 (SNORD115-15) URS000000DAFC_9606

Automated summary: This snoRNA sequence is 81 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, GeneCards, HGNC, snoDB, snOPY, RefSeq, Ensembl, Rfam, MalaCards). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (SNORD115, RF00105). Homo sapiens (human) small nucleolar RNA, C/D box 115-15 (SNORD115-15) sequence is a product of ENSG00000201679.1, SNORD115-15 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGGUCGAUGAUGAGAACCUUAUAUGUUCUGAAGAGAGGUGAUGACUUAAAAAUCAUGCUCAAUAGGAUUACGCUGAGGCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications New