Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U11 small nuclear (RNU11) secondary structure diagram

Homo sapiens (human) RNA, U11 small nuclear (RNU11) URS000000A142_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU11: RNU11 is a noncoding minor spliceosome snRNA gene that is present at a single locus in the genome and can act as a recessive Mendelian disease gene [PMC4667643]. In the context of GHomas, the expression levels of SST5TMD4 were directly associated with those of RNU11, RNU4ATAC, and RNU6ATAC [PMC6826715].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAAGGGCUUCUGUCGUGAGUGGCACACGUAGGGCAACUCGAUUGCUCUGCGUGCGGAAUCGACAUCAAGAGAUUUCGGAAGCAUAAUUUUUUGGUAUUUGGGCAGCUGGUGAUCGUUGGUCCCGGCGCCCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications