Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bartonella grahamii as4aup 5S ribosomal RNA secondary structure diagram

Bartonella grahamii as4aup 5S ribosomal RNA URS000000818B_634504

Automated summary: This rRNA sequence is 120 nucleotides long and is found in Bartonella grahamii as4aup. Annotated by 2 databases (RefSeq, ENA). Described in 2 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACUUGGUGGUUAUGGCGGAGUGAACGCACCCGAUCCCAUCCCGAACUCGGCCGUGAAACGCUCCAGCGCUGAUGGUACUUUGCCUUAAGGCACGGGAGAGUAAGUCGCCGCCAGGUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 0 other species

    1. Bartonella grahamii 5S rRNA
    2D structure New