Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-340-5p URS0000007FBA_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 3 databases (RefSeq, MirGeneDB, miRBase). Oryctolagus cuniculus (rabbit) ocu-miR-340-5p sequence is a product of miR-340, ocu-miR-340, MIR340, ocu-miR-340-5p, miR-340-5p genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAUAAAGCAAUGAGACUGAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 177 other species

    1. Bos taurus (cattle) Bta-Mir-340_5p (mature (guide))
    2. Callithrix jacchus cja-miR-340
    3. Canis lupus familiaris (dog) cfa-miR-340
    4. Capra hircus chi-miR-340-5p
    5. Cavia porcellus cpo-miR-340-5p
    6. Cervus elaphus (red deer) cel-miR-340
    7. Cricetulus griseus cgr-miR-340-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-340-5p
    9. Daubentonia madagascariensis (aye-aye) dma-miR-340
    10. Echinops telfairi Ete-Mir-340_5p (mature (guide))
    11. Equus caballus eca-miR-340-5p
    12. Homo sapiens (human) hsa-miR-340-5p
    13. Macaca mulatta mml-miR-340-5p
    14. Microcebus murinus mmr-miR-340
    15. Mus musculus mmu-miR-340-5p
    16. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-340
    17. Otolemur garnettii oga-miR-340
    18. Pan paniscus (pygmy chimpanzee) ppa-miR-340
    19. Pan troglodytes ptr-miR-340
    20. Papio hamadryas pha-miR-340
    21. Pongo pygmaeus (Bornean orangutan) ppy-miR-340
    22. Pteropus alecto (black flying fox) pal-miR-340-5p
    23. Rattus norvegicus rno-miR-340-5p
    24. Sus scrofa ssc-miR-340
    Publications New