Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-340-5p URS0000007FBA_9796

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Equus caballus. Annotated by 2 databases (miRBase, RefSeq). Equus caballus (horse) eca-miR-340-5p sequence is a product of miR-340, eca-miR-340-5p, eca-miR-340, miR-340-5p, MIR340 genes. Found in the Equus caballus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAUAAAGCAAUGAGACUGAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Bos taurus Bta-Mir-340_5p (mature (guide))
    2. Callithrix jacchus cja-miR-340
    3. Canis lupus familiaris cfa-miR-340
    4. Capra hircus (goat) chi-miR-340-5p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-340-5p
    6. Cervus elaphus cel-miR-340
    7. Cricetulus griseus (Chinese hamster) cgr-miR-340-5p
    8. Dasypus novemcinctus dno-miR-340-5p
    9. Daubentonia madagascariensis dma-miR-340
    10. Echinops telfairi Ete-Mir-340_5p (mature (guide))
    11. Homo sapiens hsa-miR-340-5p
    12. Macaca mulatta mml-miR-340-5p
    13. Microcebus murinus (gray mouse lemur) mmr-miR-340
    14. Mus musculus mmu-miR-340-5p
    15. Nomascus leucogenys nle-miR-340
    16. Oryctolagus cuniculus (rabbit) ocu-miR-340-5p
    17. Otolemur garnettii (small-eared galago) oga-miR-340
    18. Pan paniscus (pygmy chimpanzee) ppa-miR-340
    19. Pan troglodytes (chimpanzee) ptr-miR-340
    20. Papio hamadryas (hamadryas baboon) pha-miR-340
    21. Pongo pygmaeus (Bornean orangutan) ppy-miR-340
    22. Pteropus alecto pal-miR-340-5p
    23. Rattus norvegicus (Norway rat) rno-miR-340-5p
    24. Sus scrofa (pig) ssc-miR-340
    Publications