Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-340 URS0000007FBA_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAAGCAAUGAGACUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus Bta-Mir-340_5p (mature (guide))
  2. Callithrix jacchus cja-miR-340
  3. Canis lupus familiaris (dog) cfa-miR-340
  4. Capra hircus (goat) chi-miR-340-5p
  5. Cavia porcellus cpo-miR-340-5p
  6. Cervus elaphus cel-miR-340
  7. Cricetulus griseus (Chinese hamster) cgr-miR-340-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-340-5p
  9. Daubentonia madagascariensis dma-miR-340
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-340_5p (mature (guide))
  11. Equus caballus eca-miR-340-5p
  12. Homo sapiens hsa-miR-340-5p
  13. Macaca mulatta mml-miR-340-5p
  14. Microcebus murinus mmr-miR-340
  15. Mus musculus (house mouse) mmu-miR-340-5p
  16. Nomascus leucogenys nle-miR-340
  17. Oryctolagus cuniculus (rabbit) ocu-miR-340-5p
  18. Otolemur garnettii (small-eared galago) oga-miR-340
  19. Pan paniscus ppa-miR-340
  20. Papio hamadryas (hamadryas baboon) pha-miR-340
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-340
  22. Pteropus alecto pal-miR-340-5p
  23. Rattus norvegicus rno-miR-340-5p
  24. Sus scrofa (pig) ssc-miR-340
Publications