Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) pha-miR-340 URS0000007FBA_9557

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Papio hamadryas. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAUAAAGCAAUGAGACUGAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Bos taurus (cattle) Bta-Mir-340_5p (mature (guide))
    2. Callithrix jacchus cja-miR-340
    3. Canis lupus familiaris cfa-miR-340
    4. Capra hircus chi-miR-340-5p
    5. Cavia porcellus cpo-miR-340-5p
    6. Cervus elaphus (red deer) cel-miR-340
    7. Cricetulus griseus (Chinese hamster) cgr-miR-340-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-340-5p
    9. Daubentonia madagascariensis dma-miR-340
    10. Echinops telfairi Ete-Mir-340_5p (mature (guide))
    11. Equus caballus (horse) eca-miR-340-5p
    12. Homo sapiens hsa-miR-340-5p
    13. Macaca mulatta (Rhesus monkey) mml-miR-340-5p
    14. Microcebus murinus mmr-miR-340
    15. Mus musculus (house mouse) mmu-miR-340-5p
    16. Nomascus leucogenys nle-miR-340
    17. Oryctolagus cuniculus ocu-miR-340-5p
    18. Otolemur garnettii (small-eared galago) oga-miR-340
    19. Pan paniscus ppa-miR-340
    20. Pan troglodytes ptr-miR-340
    21. Pongo pygmaeus (Bornean orangutan) ppy-miR-340
    22. Pteropus alecto (black flying fox) pal-miR-340-5p
    23. Rattus norvegicus rno-miR-340-5p
    24. Sus scrofa (pig) ssc-miR-340