Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor secondary structure diagram

Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor URS0000007340_9598

Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Pan troglodytes. Annotated by 5 databases (Rfam, ENA, RefSeq, miRBase, Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-127, RF00676). Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor sequence is a product of mir-127, ENSPTRG00000027817.3, 127, MIR127 genes. Found in the Pan troglodytes reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Ailuropoda melanoleuca microRNA mir-127
    2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000010944.1)
    3. Ateles geoffroyi microRNA age-mir-127 precursor
    4. Callithrix jacchus miRNA (ENSCJAG00000026365.3)
    5. Canis lupus familiaris (dog) microRNA mir-127
    6. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000021301.2)
    7. Cavia porcellus microRNA mir-127
    8. Chlorocebus sabaeus microRNA mir-127
    9. Colobus angolensis palliatus miRNA (ENSCANG00000003328.1)
    10. Dipodomys ordii microRNA mir-127
    11. Equus caballus microRNA mir-127
    12. Felis catus (domestic cat) microRNA mir-127
    13. Fukomys damarensis (Damara mole-rat) microRNA mir-127
    14. Gorilla gorilla gorilla microRNA 127 (ENSGGOG00000031077.2)
    15. Gorilla gorilla microRNA mir-127
    16. Heterocephalus glaber microRNA mir-127
    17. Homo sapiens microRNA hsa-mir-127 precursor
    18. Lagothrix lagotricha microRNA lla-mir-127 precursor
    19. Marmota monax (woodchuck) non-coding RNA
    20. Mustela putorius furo microRNA 127 (ENSMPUG00000023457.1)
    21. Myotis brandtii microRNA mir-127
    22. Myotis davidii microRNA mir-127
    23. Myotis lucifugus (little brown bat) microRNA 127 (ENSMLUG00000017857.1)
    24. Nomascus leucogenys miRNA MIR127 (ENSNLEG00000021779.2)
    25. Pan paniscus (bonobo) miRNA MIR127 (ENSPPAG00000013220.1)
    26. Panthera pardus miRNA (ENSPPRG00000013652.1)
    27. Panthera tigris altaica miRNA (ENSPTIG00000003174.1)
    28. Peromyscus maniculatus bairdii microRNA 127 (ENSPEMG00000006052.2)
    29. Pongo abelii (Sumatran orangutan) microRNA mir-127
    30. Pongo pygmaeus microRNA ppy-mir-127 precursor
    31. Pteropus alecto (black flying fox) microRNA mir-127
    32. Pteropus vampyrus microRNA 127 (ENSPVAG00000024956.1)
    33. Rhinolophus ferrumequinum microRNA 127 (ENSRFEG00010005252.1)
    34. Rhinopithecus bieti miRNA (ENSRBIG00000018257.1)
    35. Rhinopithecus roxellana miRNA (ENSRROG00000027377.1)
    36. Saguinus labiatus microRNA sla-mir-127 precursor
    37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003979.1)
    38. Ictidomys tridecemlineatus microRNA mir-127
    39. Suricata suricatta microRNA 127 (ENSSSUG00005012097.1)
    2D structure Publications