Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor secondary structure diagram

Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor URS0000007340_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Ailuropoda melanoleuca microRNA mir-127
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000010944.1)
  3. Ateles geoffroyi microRNA age-mir-127 precursor
  4. Callithrix jacchus miRNA (ENSCJAG00000026365.3)
  5. Canis lupus familiaris microRNA mir-127
  6. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000021301.2)
  7. Cavia porcellus (Domestic guinea pig) microRNA mir-127
  8. Cebus imitator microRNA 127 (ENSCCAG00000015850.1)
  9. Chlorocebus sabaeus microRNA mir-127
  10. Colobus angolensis palliatus miRNA (ENSCANG00000003328.1)
  11. Dipodomys ordii (Ord's kangaroo rat) microRNA mir-127
  12. Equus caballus microRNA mir-127
  13. Felis catus microRNA mir-127
  14. Fukomys damarensis microRNA mir-127
  15. Gorilla gorilla gorilla microRNA 127 (ENSGGOG00000031077.2)
  16. Gorilla gorilla (western gorilla) microRNA mir-127
  17. Heterocephalus glaber (naked mole-rat) microRNA 127 (ENSHGLG00000022131.2, ENSHGLG00100024164.2)
  18. Homo sapiens microRNA hsa-mir-127 precursor
  19. Lagothrix lagotricha microRNA lla-mir-127 precursor
  20. Marmota monax non-coding RNA
  21. Mustela putorius furo microRNA 127 (ENSMPUG00000023457.1)
  22. Myotis brandtii microRNA mir-127
  23. Myotis davidii microRNA mir-127
  24. Myotis lucifugus microRNA 127 (ENSMLUG00000017857.1)
  25. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 127 (ENSNLEG00000021779.2)
  26. Pan paniscus microRNA 127 (ENSPPAG00000013220.1)
  27. Panthera pardus (leopard) microRNA 127 (ENSPPRG00000013652.1)
  28. Panthera tigris altaica miRNA (ENSPTIG00000003174.1)
  29. Peromyscus maniculatus bairdii microRNA 127 (ENSPEMG00000006052.2)
  30. Pongo abelii microRNA mir-127
  31. Pongo pygmaeus microRNA ppy-mir-127 precursor
  32. Pteropus alecto (black flying fox) microRNA mir-127
  33. Pteropus vampyrus (large flying fox) microRNA 127 (ENSPVAG00000024956.1)
  34. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 127 (ENSRFEG00010005252.1)
  35. Rhinopithecus bieti miRNA (ENSRBIG00000018257.1)
  36. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000027377.1)
  37. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-127 precursor
  38. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003979.1)
  39. Ictidomys tridecemlineatus microRNA mir-127
  40. Suricata suricatta microRNA 127 (ENSSSUG00005012097.1)
2D structure Publications