Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thermocrinis sp. 5S ribosomal RNA secondary structure diagram

Thermocrinis sp. 5S ribosomal RNA URS0000006E73_2024383

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCGGGACCAUAGCGGAGGGGAAACACCCGGUUUCCAUUCCGAACCCGGCAGUUAAGCCCUCCAGCGCCGAUGAUACUGUGCCGGGCGAACGGCACGGGAAAGUAGGUCGUCCCGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Thermocrinis minervae 5S ribosomal RNA
  2. Thermocrinis albus DSM 14484 5S ribosomal RNA
  3. Thermocrinis ruber 5S ribosomal RNA
  4. Thermus sp. 5S ribosomal RNA
2D structure