v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P1c_5p (mature (guide)) URS0000003D7D_8478

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Chrysemys picta bellii. Annotated by 1 database (MirGeneDB). Found in the Chrysemys picta bellii reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCAGCACAUCAUGGUUUGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Alligator mississippiensis ami-miR-15c-5p
    2. Callorhinchus milii eshark_mir-15_4
    3. Columba livia (rock pigeon) cli-miR-15c-5p
    4. Danio rerio dre-miR-15b-5p
    5. Gallus gallus (chicken) gga-miR-15c-5p
    6. Ictalurus punctatus ipu-miR-15b
    7. Latimeria chalumnae Lch-Mir-15-P1c_5p (mature (guide))
    8. Ornithorhynchus anatinus (platypus) Oan-Mir-15-P1c_5p (mature (guide))
    9. Sphenodon punctatus Spt-Mir-15-P1c_5p (mature (guide))
    10. Taeniopygia guttata (zebra finch) Tgu-Mir-15-P1c_5p (mature (guide))
    11. Tor tambroides (Thai mahseer) miR-15b-5p
    12. Xenopus laevis (African clawed frog) xla-miR-15c-5p
    13. Xenopus tropicalis xtr-miR-15c