Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Metazoan signal recognition particle RNA URS00032BF6C3_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCAGGCAUGGUGGCACAUGCCUGUAAUCCUAGUUACUCGGGAGGCUGAGGCAGGAGAAUCAUUUGAACCUGGGGAGGCAGAGGCUGCAGUGAGCUGAGAUUGCACCACUGAACUCCAGCCUGGGUGACAGAGUGAGACUCUGCCUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

Publications