Homo sapiens (human) Metazoan signal recognition particle RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Metazoan signal recognition particle RNA URS0003230D0E_9606

146 nucleotides
1 database (RFAM)
Found in 1 other species
88 publications
SRP RNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCCAGGUGUGGUGGCACACCUGUGGUCCCAGCUACUUGGGAGGCUGGGGUGGGAGGAUCAUUUGAGCCCAGGAGGUCAAGGCUGCAGUGAGUCGUGACGGUGCCACUGCACUCUAGCCUGGGUGACAGAGCGAGACCCUGUCUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Gorilla gorilla gorilla (western lowland gorilla) Metazoan signal recognition particle RNA

Relationships

Molecular Relationships

Publications