v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2672 URS0000EEE793_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02672: LINC02672 is a long non-coding RNA (lncRNA) that has been found to be significantly up-regulated in various cancer cell lines and cancer tissues compared to normal cells and tissues [PMC8093983]. It has been shown to be correlated with the expression of IDO1, NRP1, and TNFSF4 in pan-cancers [PMC8093983]. Additionally, LINC02672 is associated with the abundance of CD56 bright natural killer cells, mast cells, and immature dendritic cells in pan-cancers [PMC8093983]. It is also significantly correlated with predicted SNV-derived neoantigens in bladder cancer and uterine corpus endometrial carcinoma [PMC8093983]. Another lncRNA, PSORS1C3, has been found to be significantly correlated with the expression of CD160, CD40, and TNFRSF14 in pan-cancers [PMC8093983]. PSORS1C3 is also associated with the abundance of activated CD4 cells and gamma delta T cells in pan-cancers [PMC8093983]. RP11-89 is another lncRNA that is highly expressed in tumor samples along with PSORS1C3 and LINC02672 [PMC8093983]. On the other hand, MIR100HG is highly expressed in normal samples [PMC8093983]. These four lncRNAs (RP11-89, PSORS1C3, LINC02672, MIR100HG) were used to construct an immune-related prognostic lncRNA signature (IRPLS) that could potentially serve as a target for individualized immunotherapy for bladder cancer patients [PMC9604712]. References: - PMC8093983 - PMC9604712

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUCCAUGUCUCUUUCACUCACUGUGGUCAGCUUCCACACCAUUUCUUUGGUGUGGCUUGGCAAGAACCUCAGGUGUUACAUCUUGGCGAGCCAGACAGGAGACUCCAGAAAAGGUAUCUAGAUCAUCAUGCAGGGUGAUUUUCCUGUACCAGUCCAAUGCCUCCAGAGGAAGAUCAUACAUUUGCCAUUUUACUGCUUAGUACGCAUGCUUGAGCCUGCUCGCCCAACUGCUGAGAUCUUAUUCAGAAACUGCUGAUCACCAACUCCAGGUGUUUUUAUUACACAAGACAAAAACGGAAAAACAGUAACAAAUGAUUGGUUAAGCCUUUCAAAACAAAGAAGUUAUGCCUGGAGUGGGAGGAACAUUACACUAUACUUCUUUCUCCUCCUUCAUUAGUGAAGGUCACUGGAAUAGGUUCAUUACACUCAAGCAAAGGCCUGGGGAAAUGAUAGAAUUACCUCUGUUGACCCAGAAGAGCACCAAAAGCACCAGUGUGCAGAAAUCAGAGACCUCAAGCUAAAAGUCAUAAAAGGACAAGAACCUGGAAGUCGUCGAACUGUGGAAGCAAAAGACCUGUAAUGCUCCUGCUUGCCGAGCUGUGAGCAGUGGUAGUAAAAGAGCAGUAACAUUCUCUCCUGCUUGCCAAACAGGAGAGAAGCCACUGGCACCACUCCCUCCCACUCACUGAACUAUAGAAGAGAAAAAAUUGAAACACCAAAAUUGGGGAAAUGCGACUUUUGCGAAAAUUUGAAAGUGCAUGCUUCACAGAAGGAAGGGGGAGCUGGUCUAUUAUGUCUCACUAUAACAAGACUAAAAUUUUGCAAAUAAAUUGUUCCUGCCAUAAUUUAUCCUUGGUAGAAAUGAAGAAAUUGGAGAGAGAAAAAAUUGGAUUCUAGGUCCUGACCAUUGUUUUUGAAUUUUUAUUAUUUUCCUACAAUUUAGGCUAAAUUCUGAACUAUUUGCUGGCUACAAGAGGCCUCUAAAAAAGAGCUGGGUUUUAGUUUUCUUCAUGCUCUUUAAAAACUGGCAUAUAAUGGUGUGUAUCUCUCGUUGUUUUACUUCUAAGAAACUGAAGGCAUGAUAUUCUGAAGACUAGAGGUGAUUCAAUAGCCUAUGAAUCUUCUUCAUUUGGAACCCCACUGGGCCUGAUCUGUUUCCCAUCACCAAUGCACUUCUGCUAAACCUAUAUCCUAUCAAGUACUCUCCCUAAAUGCUCAGAGACCAUAACAGAAGAUGAGGGUGUGUGAGAUUAUAAAAGCCAAAUUAGUGGAGUGGAAUCUGGAGGCUAAAGCAACUCCAUCUUGGAUGCUAAUCUGCCAUGUUGGCUUCUGAUUAACCCCAGUUCUGGAGGGCCUCUGAGGUUUCCAAUUUAUCUACUGUCCCUUGUGUAAGAACAAGUACUUAUCAUAAAUCCUGCUAUUAGGGCAAAUUUCUACCCAUUCCCUCUGAAGCAUGUGCACCUCUCCUCUACAUGUAAUCUCCCCUACAAUAGAUAAACCCCUCUGGGUCUGGGGGCUAAUAGUGUGGGAACCCAUCAUCUUGCCUCACUGCUGCACAAGCCACAGGUGUGGCUUCUGUUUCUAAGUCCCUAUUAAAUGUUUCUAGAUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications