v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2688 (LINC02688) URS0000E60B51_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02688: LINC02688 is a long non-coding RNA (lncRNA) that has been studied in various types of cancer, including cervical squamous cell carcinoma (CESC) and gastric cancer (GC) [PMC9523019] [PMC8099719] [PMC9168541] [PMC9871836]. In CESC, a unique prognostic risk model was developed that included LINC02688, along with 10 other NRlncRNAs, to predict patient prognosis [PMC9523019]. LINC02688 was found to be significantly down-regulated in 68% of CESC tumor tissues compared to adjacent non-tumoral tissues [PMC8099719]. In GC, LINC02688 was also downregulated in tumor tissues compared to adjacent non-tumoral tissues and its expression decreased with the progression of the disease [PMC8099719] [PMC9871836]. Furthermore, LINC02688 expression was found to be associated with H. pylori infection in GC patients [PMC8099719]. In prostate cancer (PCa), LINC02688 was included in a prognostic model along with other lncRNAs to predict biochemical recurrence-free survival of patients [PMC9168541]. The expression of LINC02688 was negatively correlated with the m7Gscore, which is a measure of m7G-related patterns associated with PCa prognosis [PMC9168541]. Overall, while there is limited research on LINC02688 compared to other lncRNAs studied in cancer, its downregulation has been consistently observed and it shows potential as a biomarker for prognosis and disease progression. Further studies are needed to fully understand the role of LINC02688 in different types of cancers and populations.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAAUGGGGACGUCGGGAGCAUUCUCUGGACAGCAGGAGAUGCAUGUCGACAGGCUGGCCCUGCCUCUUCCCACCCCAGAGUGAUGCAGCGGUGUCCUGGACCCCUGGGGAGAGGUGACCCCCCCAGCAGGAAGCUGGGCCUGGUUUCUGUCCCUCUGCAGCCACAAGGCCUGGCUAGGAUGCUGGGAGCACCACACCCUGGAGACUCAGCUCACCAAGGACUCAGGGGCGGGGGCUCCCCUGGCACCUGGGAAGCUGGGCCCCCGGCCCCCUGGACUCCCACCCAGACACCAUCUCAACCCAGGCACUUCCCCCGGGCCAGAGGGCAGCCUGGCAGCCCUGGACUCCGGGAGGGCCGAGUCUGGGGAGCUGGACGACGUCACAUUCCACUCUUGAUGAUGCCGCCCCAGUCCUACAAUCUGGACAGCAGGAGAAGCUGCCCAUUUCCUCCAUCUCCGGUCCCUGGAGGUUCCCCGGAUCCUUUCAGGGAAGACCAUGGGCCCUAAACGAUCUUCAUAACAAAACUGAGAAGUGGCCUGGCUUCUUCACUGCGUGCCUGUGUGCUGGGAUCUAGCGUGGCCCGACUGGGCAGCUCCUUUCCUUCCCUGACGCUGCUCCAGGGGAAAGAAGGACCAGGGUCAAUCCGGGGUGCCCCAGGUGGAUCAGCGAAUGCCCCUGAAGCCAGGUGCCAGUUGCAUCCCCGUCAGAUGCCCCCACCCCAGUCUCCUGAGCCUCAUUAGUCACCCCUCAUUUUCCUCUGGGGACCCCAGGCCCCAGCUCCUGUCUGGUUAGAGGCUGAAGGGGUCUGAGCGACACCUACCCUAGGGGACCUCCGGAGGGGUCUUGGUGUCCUCUGACUUCUGUCCUCAGAAGGGAGCUCAGAAUGCAGCUGAGGCUUCCCCUGGGGCCCAGGGUGUCUGUGUCCGAGCCACAGCCAGAGUGUGCCCUGGAGAGUCGCUGGGAUGCACGGUGGGCUCUCGUCAUCCUGUCCCCACUCCAGGCUCAGGCUGGAGCCGUGAUGGCACCGCUGCACUCCAACCUGGGCAACAGAGUGAGACCCUGUCUCUAUAAAAUAAAAACAAAAAUAAAGAAGAGCAUGUGGUUUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications