Homo sapiens (human) long intergenic non-protein coding RNA 515 (LINC00515)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 515 (LINC00515) URS0000CCE13C_9606

459 nucleotides
3 databases (EVlncRNAs, HUGO Gene Nomenclature Committee, RefSeq)
Found in 1 other species
49 publications
lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

linc00515: LINC00515 is a long non-coding RNA (lncRNA) implicated in the pathology of glioma, a type of brain tumor [PMC9068894]. Research involving the knockdown of LINC00515 in glioma cell lines, specifically U251 and U87MG, has been conducted to elucidate its function [PMC6497836]. A study by 2020e highlighted LINC00515 as one of five immune gene–related lncRNAs associated with the prognosis and clinical characteristics of glioma patients [PMC9068894]. Moreover, LINC00515 has been found to have a positive correlation with the expression of immune checkpoint molecules such as PD-L1, TIM-3, and B7-H3 [PMC9068894]. These findings suggest that LINC00515 may play a role in the immune response within the glioma microenvironment and could potentially serve as a biomarker for patient prognosis or as a target for therapeutic intervention [PMC6497836; PMC9068894].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCUGCCCUUCCUUGCAGCUGUGGCUCAGACAGGUAGCAUGGGCUCACCAAUUAGACAUAACUGUGUGAAAUCUGGAAGCAAGUACUUUGCAGACAAGAGUAGUAUGAGAUACAUUUUGUUGAACGGAGCAGUGAUGUGGUUUUCAAGGCAGCAGUGGCAGAGGUCCCAUGUAAUGGUGCAAGGUGUGGAGGCUUUGCUUAGCAGUUUUUCCCCCGCAGCUGCUCCAAGGUAUAAAAAUGGGCAUUUUUGGGGGCUCCGUAGUCCUGACCUCCACGCCUGUGACUUGUGAGCCAUUUUAUUCUGUUUGUUUAAACUAGCUAGUGUAGAUCCUGUUGUUUGUAACCAAGAGUGUUGACAUACAGCCACUAUUUAAUUGUAACCACUGUCAACCUUUUUCCUUAUUUCCUUCAGAUCCUUUUGUGUUUAAAUAAAGGAAAAGCUGCACAUCCAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications