Homo sapiens (human) papillary thyroid carcinoma susceptibility candidate 2 (PTCSC2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) papillary thyroid carcinoma susceptibility candidate 2 (PTCSC2) URS0000BC465E_9606

1,947 nucleotides
8 databases (Ensembl, ENSEMBL_GENCODE, Expression Atlas, GeneCards, HUGO Gene Nomenclature Committee, LncBook, MalaCards, RefSeq)
Found in 0 other species
64 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ptcsc2: PTCSC2, identified as a long non-coding RNA (lncRNA), has been implicated in autophagy-related processes with potential prognostic significance in oral squamous cell carcinoma (OSCC) [PMC9574005]. This lncRNA was part of a large-scale bioinformatics analysis and its prognostic value in OSCC was verified through RT-qPCR and clinical sample analysis [PMC9574005]. Additionally, PTCSC2 is associated with the susceptibility to papillary thyroid carcinoma (PTC), particularly in the presence of the A allele of SNP rs965513 [PMC8125431]. The functional mechanism of PTCSC2 in thyroid carcinogenesis may involve its interaction with the binding protein MYH9 and the thyroid-specific transcription factor gene FOXE1 [PMC8125431]. However, the significance of the interaction between MYH9 and PTCSC2 in cellular processes or disease pathogenesis requires further investigation, as the provided references do not elaborate on this aspect [PMC5885413].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACAGCGUCAGGGCGGGGAGGGCGCUUGGAGAUCCCCCGGGUCGGCCCCCUCCGCACCCCGAUCGACUGAGGCCCGGAGAGUUCAGGAACCGGCUCGGGAGACCUCAGCGCCCGAACUCGGAGUUUUCGGACUUUUCAGGCCUCUGCCAAGGGCUUGGACUCGCAGAUGGUGGAAAGCUGCACUUGAAGUCCAACUCUGUCCUGGGGGAAUAAUUAUGUUCCCUGUCUUGGGAGCCUUUCUUCAGGGAGCUUGAUGGUUCCAACCCACCCAGGAGCCUGGGACAUCUGUGCCCCUGGGCAAUCCCCUGCAGUUUCCUGAUUCCAAGAUGAGGGGGUAGAAUCCGAAGAUCUCCAAGGCCUUGAUGAGUGCUACCAGUCUGCAAAUUCCCAAGCCAAGUUCUUCAAUGAAUCAAAUUUCCUCCAGUAGCCAUUUCUACCAAAGGAGCAACUGUUUUUCCUUCCCACUGACAUGGCUAUGUAUUCGAACUGGAUAUAGGACACUGGGACCUGAAGUCUUGGAGAGGAUGUAAUCACUAAGUCAUCCCAAGGAAGAGUGGGAUGCCUACAAGAGAGGGAUGCCUACAAGAGAGGGAUGCCUAAAUUGGUUACCCCUAAGCCCACCGACUUUUAAGGCAUGUCAGCUCCAAGGACCAUGGCCCCAGGAACUAGGCACAAGUGACAGGAGACACUUGCUAUGUCUAAACCCAGUGCACCCUCAGCCCGGCCUCGCCUUUUCAAGGACGGCUAGCACAGGCCAUCAUCCUGGCCCACGAUGAAGGAUCUCUCUCUGCCACCCAGGCUGGAGUGCAGUGGCACAAUCAUGGCUCACUGCAGCCUCAAACUCCUGCGCUCAAGUGAUCCUCCCACAUCAGCCUCCCAAGUAGCUGGGACUCCAGGUAUGAGAGAACAGAAAUAGAGAUUUGGGUGGCUUUAGCUGUUUAAAAUAAGGUGACCAAACCUCCUUUCUGCCUGUUCCUGCUAUUUCAAACACCACUGUUCUCCACACAAUGAAAAUGGCCUUGUUCCUUAAGCCAAAGAUAGCUGAACUUUUGUUUGACAUUUUACACGGUGUCUUAUACCUGCCUGAAAGAAGGGGUGCAGGUCUUCACAGAAUGAGGAAAGGCCAGAGAUUUGGACUCCAAAGACCACAGCUUGGAUUCUAAGCUGUCACUUACCAGCCAAAAGGGAAUCUUGGCCCAGUCACUGAAGCCCCCUGAGUCUCAACUACCUCAUCUGUAAAGGGUCUCAUCAGGCCCACAUUAGAUUAUCUACUCGACCAUCAGUUCAAGCUCUAAGGUAAAGAUGUAGAGCAACUGGAACUUUCAUACACUGCUGCAACCACUUUGGAGACUAUCAGCAUUUUCCACUAAAGCUGAACAUUAUGGUCUAGAAAUUGCACUCCUGAGCAGCUUCUGAGAGAUGGGGGACGUGGAGCAGUCCUGGGUCUCAUGGUCUGAAGGGAGAAGAAAUCCUGCCCAGGCAGACCACUGUGAAUGUCCAGGCUUGUUUCCACCUGAACAGACUCUCCCUUAGCUAAGAGAACCAGACAAACUCCAUCUUGGCUCUUUCACUGGCAGCCCCUUCCUCAAGGACUUAACUUGUGCAAGCUGACUCCCAGCACAUCCAAGAAUGCAAUUAACUGAUAAGAUACUGUGGCAAGCUAUAUCCACAGUCCCCAAGAAUUCAUCUGUUUGAUAACGCCCAAAGCCCUGCAUCUAUAACCUUGUAAUAGUCUUAAAGCCCCUGCAUCUGGAACUGUUUACUUUCCUGUAACCAUUUAUCCUUUUAACUUUUUGACUACUUAACUUCUGUAAAAUUGUUUUAACUAGACGACCCCCCCUUUCUAAACCAAGGUAUAAAAGUUAAUCAAGCCCCUUCCUCGGGGCCGAGAGAAUUUUGAGCGUUAGCCGUCUCUCGGUCGCCGGCUAAUAAAGGACUCUUAAUUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Expression

Publications