Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ACBD3 antisense RNA 1 (ACBD3-AS1) URS0000BC4615_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ACBD3-AS1: ACBD3-AS1 is a long non-coding RNA (lncRNA) that has been studied in gastric cancer (GC) [PMC8325795]. In GC tumor samples, the expression of ACBD3-AS1 is higher, suggesting that it may function as an oncogene [PMC8325795]. ACBD3-AS1 expression does not differ significantly between different risk groups [PMC8325795]. However, it is lower in normal tissue compared to tumor tissue [PMC8325795]. ACBD3-AS1 is closely associated with several m6A lncRNAs in GC and its expression increases with the increased expression of these m6A lncRNAs in GC cells [PMC8325795]. Overexpression of ACBD3-AS1 has been shown to enhance cell viability and inhibit apoptosis by stimulating the expression of apoptosis-related genes [PMC8325795]. Additionally, ACBD3-AS1 has been found to interact with the JAK2 signaling pathway, suggesting its potential role as a tumor promoter in gastric carcinoma [PMC8325795]. ACBD3-AS1 is most positively correlated with AC092119.2, AC007038.1, AL139287.1, SNHG12, and C3orf35 [PMC8325795]. Its higher expression in cluster 2 indicates a potential harmful effect on the prognosis of gastric cancer patients [PMC8325795]. The overall survival rate of GC patients is highly related to the expression of ACBD3-AS1 [PMC8325795]. However, further studies are needed to fully understand the role of ACBD3-AS1 in GC cells and its potential as an oncogene [PMC8325795]. The differential expression analysis and correlation analysis further support the prognostic value of ACBD3-AS1 in GC patients. It was found that its higher expression was associated with the high-risk group in gastric cancer [PMC8325795]. In a different study, ACBD3-AS1 was identified as one of the top markers in cluster 8 of airway epithelium, indicating its potential role in lung-related analysis [PMC9889806]. Overall, ACBD3-AS1 is a lncRNA that shows differential expression in GC and is associated with various molecular pathways and potential prognostic markers [PMC8325795][PMC9889806].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGUGAAUUCUGGCAACACACUGAGUGAUGCUUGUCAAUGGCCACUAUCAGGAAUUUAAAACAAGAUUUGGAAUUAUGACAUCUGGACAAACACAUAUGCAAAACCUACCUUUUGGUCCAUUCUCCAGGGCUUCUUCUGCAGCUUCUGGUUCCAGUUCUUUUUCGGAGCUGUCAGUGUGUGUUUUGGCCUGUCCAUUAACUGACAUCAUAUUACUUGGUACAGUUGCAUUCACUUUUGAUGAUGUAGGCAAGGAAGACCCAGCCACUACUACUUCCUGUUGUUUCUGUAAUGCUGCCUACAAACCAAGAGAAAGUGAAGACACACUGACCAGGAAGGCUAGCAAAUAAGACAUCUGCCCUGGAGUACAUCUGAUACCAUGCUUUUGCCCUACCAAAGUGCUAUGCUCAAGAAAUUACUAAUAAAUUUUUAUCAGUUUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications