Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2474 (LINC02474) URS0000BC4419_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02474: LINC02474 is a novel long non-coding RNA (lncRNA) that has been identified as differentially expressed in a study [PMC8063044]. The researchers focused on LINC02474 for further investigation due to its potential significance. Subsequent analysis using RNA-seq data revealed that depletion of LINC02474 could potentially impact the expression of cancer-related genes, including GZMB [PMC8063044]. This suggests that LINC02474 may play a role in cancer development or progression. Long non-coding RNAs (lncRNAs) are a class of RNA molecules that do not encode proteins but have been found to have important regulatory functions in various biological processes [PMC8063044]. The identification and characterization of differentially expressed lncRNAs, such as LINC02474, can provide insights into their potential roles in disease development and progression. Further studies are needed to fully understand the functional significance of LINC02474 and its potential involvement in cancer-related processes. Investigating the mechanisms by which depletion of LINC02474 affects the expression of cancer-related genes like GZMB could provide valuable insights into the underlying molecular pathways involved [PMC8063044]. In conclusion, LINC02474 is a novel lncRNA that has been identified as differentially expressed and may have implications for cancer-related gene expression. Further research is needed to elucidate its functional role and mechanisms involved in cancer development or progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCCUGCUCUUUGCUCCGUGAGAAAGAUCCACCUACGACCUCAGGUCCUCAGACCGACUAGCCCAAGAAACAUCUCACCAAUUUCAAAUCUGACCUUUGCAAGAGGGUCCGAGACAUUUGCAUCAUCAUUCAGUGAGACCUGUAAACACAGCAUCUGCCUUUGACCACAUCCAUCUGGAAGAACCUGAGAGAUAAUCCAUUUUAUGAAAUUUUCCCUACCCUGAAAUGGGAGAAUGAAUCUAAUUUGAAGCACUGAGAAGGAUAAGGCAUCCAUUUGAAAAGGACUCCUAUAUUGCAACAUGAAUUCUGCUAAAAUUGAAGCAAGAACAAACAUCAAAUUUAUGAUGAAGUUUGGGUAGAAGAACGAUGAAAUUAGUGACGCUUUAUAAAAAGUUUAUUGGGACAAUACCCCAAAUGAAUCAGCAGUUUAAAAAUGGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications