v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) IER3 antisense RNA 1 (IER3-AS1) URS0000BC43FA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

IER3-AS1: IER3-AS1 is a transcript that colocalizes with IER3 and is associated with an increase in the stability of both transcripts [PMC9424213]. The colocalization of IER3-AS1 and IER3 is linked to an increase in the expression of IER3 at the post-transcriptional level [PMC9424213]. This interaction between IER3 and IER3-AS1 transcripts was observed in RNAscope experiments conducted on HeLa and HEK293 cells, as well as in FGF-2 treated HeLa cells [PMC9424213]. Furthermore, the regulation of chemokines by FGF-2, IER3, and IER3-AS1 was validated using RT-qPCR [PMC9424213].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAUUGCCACAUCUCGGAUUCGCCGCGGGGCAACUACCUGGGAAAACCGCAGACUGGGCAAUGAAAGACUACAUCCGGCAACCGGAUGCUGGGUUCUGUGACUCCAGGAAAAGGGGCUCCUGGGCCCAGGGAGAACAUACUAGGCGAUCUCGACAGUCGCUCCGUGACAGCCCACCAACCCCCAACCCUCUACCUCGCAGCCACCCUAAAGGCGACUUCAAGAAGAUGGAAGGAUCUCACGGAUCUCAUUCCUAAUGGUCCGCCGAAGUCUCACACAGUAGACAGACGGAGUUGAGAUGCUGGAGGAUGCAGUCACCUCCUAAACUUACGACCCACCACCAGACUUCAUCCCAGCCGGGACGUCCUCCCCCACCCGAGUCCUCCCCAUUUCUUCUCCUACUUUGCCGCAGUUCCAGGUGUCCUGCUUCCACCAGUCCCACAAAGCUCAAUAAAUACCAAGAGACCUGCAUUUACAGCAGGGGGAACAUCUCACACCCUUGCAUAAGUUAAAAUAAAUAUUACGUACACAUCUCCAUCACCUAGGAGGACGUACAUAAAUACAUAUAAAUAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications