v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXP3 regulating long intergenic non-coding RNA (FLICR) URS0000BC43DA_9606

  • 106 nucleotides
  • 2 databases (HUGO Gene Nomenclature Committee, RefSeq)
  • Found in 1 other species
  • lncRNA
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

flicr: FLICR, a long non-coding RNA (lncRNA), has been observed to have higher expression levels in patients with multiple sclerosis (MS) compared to control subjects, as indicated by a significant elevation in a study [PMC9461285]. This lncRNA plays a regulatory role in the immune system by influencing the expression of the transcription factor Foxp3, which is crucial for the development and function of regulatory T cells (Tregs) [PMC8954347]. Specifically, FLICR acts as an inhibitor of Foxp3 expression, which leads to the suppression of Treg cells through alterations in chromatin accessibility [PMC8954347]. This suppression could contribute to the immune dysregulation observed in MS patients.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGGCCCAUUCUGGGCUUUUCCAGAAGGGUCUGAAGCCAGUCUUGUAGAGGGCUGGAGUGGUUGUUGGACGACUAGAACCCUGGGCUUUGCAGGGUGCUGGGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships