v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) neighbor of BRCA1 lncRNA 2 (NBR2) URS0000A77648_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NBR2: NBR2 is a long non-coding RNA (lncRNA) that plays a crucial role in various biological processes, including cancer development and energy stress response. Knockdown of NBR2 has been shown to abolish the inhibitory effect of curcumin on colorectal cancer cells [PMC9599102]. NBR2 is down-regulated in Ang II-induced myocardial hypertrophy, indicating its importance in myocardial hypertrophy [PMC9275985]. Glucose starvation increases the interaction between NBR2 and endogenous AMPKα, suggesting its involvement in energy stress response [PMC4814347]. In the context of phenformin treatment, NBR2 has been found to contribute to the adaptive response of tumor cells [PMC6901916]. The interaction between NBR2 and AMPK forms a feed-forward loop mechanism that modulates cancer glycolysis and tumor progression [PMC8275123]. Knockdown of NBR2 inhibits AMPKα activity, leading to unchecked cell cycle progression, altered autophagy/apoptosis response, and enhanced tumor formation [PMC7215767]. Under energy stress conditions, NBR2 down-regulates apoptosis while promoting autophagy, thereby inhibiting breast and kidney cancer progression [PMC8674783]. Methylation-dependent repression of NBR2 by MBD2 has been observed [PMC1181861]. The genomic region between BRCA1 and pseudo-BRCA1 genes contains a partial copy of the NBR1 gene known as NBR2. This partial copy is situated head-to-head with BRCA1 gene and may have functional implications [PMC8674783]. The interaction partners or additional proteins involved in the NBR2-AMPK complex are not yet fully understood. However, overexpression of NBR2 inhibits epithelial-mesenchymal transition (EMT) process in thyroid cancer cells, leading to reduced invasion and wound healing [PMC7304297]. The expression level of NBR2 is associated with the progression of various cancers [PMC8674783].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAUGACGUAAAAGGAAAGAGACGGAAGAGGAAGAAUUCUACCUGAGUUUGCCAUAAAGUGCCUGCCCUCUAGCCUCUACUCUUCCAGUUGCGGCUUAUUGCAUCACAGUAAUUGCUGUACGAAGGUCAGAAUCGCUACCUAUUGUCCAAAGCAGUCGUAAGAAGAGGUCCCAAUCCCCCACUCUUUCCGCCCUAAUGGAGGUCUCCAGUUUCGGUAAAAGUUUCAUUUGAUCUGAAUAGUAUUAAAAUAAAAUACCUGGAUGAGGAAGAUGAAGAGGUGCUGGAAGCCCAGGAAGCACACAUCAAGGCUCCCUUGCCAGCAGGGUGCUGCCAAUAAAAGGUAGUCACGUGGAAUUUGGAAUGUGGAAAGGAGGUAGAAGUCAUCCUUUCCUCCCCUGUAGCAGCAGGCGUGCAGGCUCUGGUGGUCAGCUGGACUCCAUACUCCCCCACCAGUCACCAGCCUGGGGACCGUGGGGCUGCAAGGACCUCAGCAGCGGUGUCCCAAGUUUCCUGACUUCUUCCAUCCUCUGGAAAUCAGCUGUGUUUGCUGAGGAUAAUGGCCUCAAGAUCCAUCUGUGUUCCUACAAAAGAGAUGAUCUUGUUCUUUUUUAUGAUUGCACAUCUUUUGUUCUAACGUUUGGUCCUUCACCUUGGUUCCUGACACAAGGAUUCCUAAAUCCCUUGGAAUUUUCUGCAUGAUAGGAGCGUCCUUUGUUCUCAUGAGGUGACUCUUGGUGGGCUCCUUAUUUGGGGACUGGUCACCAAAAAUACCUAACUAUGGUUGGAAGCUUAGUGCUUUCAGCCCCAUUCCCCAUCCUCUGGGGUGGGGAGCAGAGCUGGAGCUCGAUCAUGCCUGCGUGACAAAGCCUCCAGAAAAAUCCUUGAAAGACAGGACAUGGAGAGCUGCUGGGUUGGCGAACACAUCCAUGUGCCGGGAGGAUGGUGCACCCCAACUCCACAAGGACCCUUCCAGACCUCACCCUGUGUAUCUCUUCAUCUGGCUGUUCAUUUAGCAGCUCCGAGGGCAGGCAUGGUGGCUCAUGCCUGUAAUCCCAGCACUUUGGGAGGCCGAGGCAGGUGGUUCAUCUAAGGUCUGGAGUUCGAGACCAGCCUGGCCAACAUAGCGAGAGCAGCUCCGGUGGCGGGAGGAGUGGCAGCGGCCAGGCAGCCCAGCUUCGCGAAGGCUGUAGGCACACCGCGGCCAGCAGGCACCUGGCACCCACCUUCCCUGCUGCCAGGAUGCCCAAGAAAAAGGUCAGCUCCACCGAAGGGGCUGCCAUGGAAGAGCCCAAGAGGAGAUCAGCGCAAUUGUCAGCUAAACCUCCUGCAAAAGUGGAAGCGAAGCCGAAAAAGGCAGCAGCGAAGGAUAAAUUUUCAGACACAAAAGUGCAAAAAAAGGGAAAAGGGGAGCAAAGGGAAAACAGGCCGAAGUGGCUAACCAAAAAACUAAAGAAGAUUUACCUGCAGAAAACAGGGGAAACGAAAACUGAGGAGAGUCCAGCCUCUGAUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications