v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MPP7 divergent transcript (MPP7-DT) URS00009C60AC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MPP7-DT: MPP7-DT is a long non-coding RNA (lncRNA) that is expressed to a great extent in human bladder cancer tissues [PMC9715909]. In a study, PCAT7, UBE2Q1-AS1, LINC01184 (SLC12A2-DT), MPP7-DT, and FAM87B were found to be expressed at high levels in human bladder cancer tissues [PMC9715909]. These lncRNA genes were selected for experimental verification in both bladder cancer tissues and normal bladder tissues [PMC9715909]. The up-regulated lncRNA genes in the prediction model included LINC01184, AL731537.1, AL390236.1, MPP7-DT, and FAM87B [PMC9715909]. Through multivariate cox regression analysis, nine lncRNA genes were identified for inclusion in a predictive signature: PCAT7, LINC01184 (SLC12A2-DT), BX546450.2, AL731537.1, AL390236.1, AC021321.1 MPP7-DT FAM87B and UBE2Q1-AS1 [PMC9715909]. In the high-risk group of bladder cancer patients, LINCO1184 AL731537.1 AL390236.1 AC112721.2 MPP7-DT and FAM87B were up-regulated while PCAT7 BX546450.2 AC021321.1 UBE2Q1-AS were down-regulated according to the heat map of the expression profiles of candidate lncRNAs [PMC9715909]. Reference: [PMC9715909]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGCCCGCCCGGUUCGCUCGCCCUUGGUUCCCACUCCCAGGUGGCUGCAGACUGGAGUGUGUUUCAUGGACGAGCAACCUCCCUGAGGAGAACCCCGGAUACGCAGGUUCAUUCGCCAGAUGCGAGUUUUCUUAAGCCGCUGCGAUUCUCUGAUUUCAGUAUGAACUUGAGUCACCAGUAAAAUGAGCAUUCAUUCAUUAAGCCAAUCAUCAGGAAUGGAUCUAGGAAGAACCUACUGUUUACUAGAAAUAGGUUAGAUCUGUGGAUAUAACAAUGAAUAAGACAAGACUGGUGGAUCUAUAGAGAAACUAUUACUGCACAGGUGAUGGGGAAAUCAAGAGUACUAUGGGGCCAAGGAGACUGUCCUGCAGCAAAUGAGGAAUAAGCUGAAACAUCAGUAGGAGCCAUCCCAGAGAAAAGGGACAGGGUUCUAGAUCCAGAGAACAACAGAAGAGCAUUCAGCGCCUGCAAGGGAGCAGGGGAUCUAAUGCAAAGCCAUUGCAUAACCAGUCAACUUUCCCCACAUCACAAGAUUGCCUAGCCUGGAUGGCCCCAGAAUGUUGAAACAAAUGUCUAAUUAGUAACGACAUUCUGAAUGCUUGGGAGCUGAGCAAAAUAUGAGGAGAAGCAACCUGAUUUUUGUUUCAUAUUAUCAUCUCCUUUAUUCCAGCAACAAAAGACACUGAAAAUAGUAAAUGCCCACUUUCAACCAUGACAGCCCUUUUAGGAUAGUAACGGCAUUCCGUAUGAGGACAUCUGUCCCCACCCCUGGAUGAAAACUUGGGUGAUCCCGAAAUUUUUCUGAUUGCUCACAGGUAAUAAAAAUCAUUUGGUCAGUUUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications