Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA host gene 19 (SNHG19) URS00008E39F5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNHG19: SNHG19 is a long non-coding RNA (lncRNA) that is downregulated in certain conditions, such as in the human AD brain [PMC9892334]. In the context of Alzheimer's disease (AD), SNHG19, along with other lncRNAs such as LINC00672, RNF144A-AS1, LY86-AS1, and LINC00639, has been found to be associated with the pathology of AD [PMC7594522]. FISH analysis has shown that SNHG19 RNA co-accumulates with polyadenylated RNA in pA+ RNA foci [PMC5972229]. In cells depleted of ZFC3H1, a protein involved in RNA degradation and processing, SNHG19 RNA is stabilized but does not accumulate in nuclear foci [PMC5972229]. SNHG19 has also been found to be upregulated during viral infection [PMC7111612]. In mice, SNHG19 has been shown to correlate with several protein-coding genes involved in various biological processes such as leukocyte transendothelial migration and apoptosis [PMC7809420]. Depletion of MTR4 or ZFC3H1 and ZCCHC8 does not result in pA+ or SNHG19 RNA accumulation in nuclear foci but instead leads to a more diffuse distribution of these RNAs within the nucleoplasm [PMC5972229]. References: - [PMC9892334]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9892334/ - [PMC7594522]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7594522/ - [PMC5972229]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5972229/ - [PMC7111612]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7111612/ - [PMC7809420]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7809420/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUUCGGGGUCGAGUCCGAGGGGGAAGAGGUUUGUUAAUACGUUCGCCAUGUGCUACGAUCUUGGGACGAACUGAGCCACGAGCGUGGCUUUGAGGGCCGUCCGAACGCUGCAGGCCGGCCAGGUCCCUGGGCGUCCAGGCCUGGCCUACGCACCACUUUGUCCCUUAGCGUUUAAAGGUUUCUUCCCGAAUCUCAGGCCCUCAGCUACCUGCAGGUUUCGUCGCGAGCCGGCUGCAAGUUUUGAACCUAAGUAAACCUCAAUCCGGAGGGCCUAGCGGUAAGGUGGGCGCUGUGUCUAUUGAAGUGCUUAGCAAUAAAGAAAGGUAGUGAGUUGAUUCGGUUUUCUCUCAAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications