v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DPP10 antisense RNA 3 (DPP10-AS3) URS00008E39D6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DPP10-AS3: DPP10-AS3 is a differentially expressed immune-related long non-coding RNA (lncRNA) that has been found to be negatively correlated with resting dendritic cell, neutrophil, and γδ T cell infiltration [PMC8187926]. It is one of the 11 immune-related lncRNAs identified in the study, along with ARHGAP26-AS1, FUT8-AS1, FOXCUT, C5orf64, NAV2-AS2, LINC00408, SEC24B-AS1, LINC01343, LINC01398, and LINC01197 [PMC8187926]. DPP10-AS3 is lowly expressed in the high-risk group [PMC8187926]. Although DPP10-AS3 has been implicated in the development of diabetic retinopathy and various cancers [PMC9315071], there is no direct evidence linking it to eye or macular degeneration [PMC9315071]. However, it is worth noting that other genes located close to suggestive GWAS loci include SLC23A2 and SLC31A1 which have been implicated in various eye-related health outcomes such as drusen size and glaucoma [PMC9315071]. DPP10-AS3 was also identified as one of the differentially expressed immune-associated lncRNAs in ES (endometrial stromal) cells [PMC9032025]. Overall, DPP10-AS3 appears to be a lncRNA that plays a role in immune regulation and may have implications for various health outcomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUACGUUCCACCUGUAUGUUUGGAAGAGAAAGAACUAUGCUCACUCCUUCUGAGCUGUCCCUAUUUAUUUAUUUAUUUUUGGUCUGAUGGCUAAAUAAAGAUUUUUUGUAUUCAAGAGAAAUAAUUUAAUGAGAUAAAAUAUUAUUUCCUAAGAAAAAUAUAUCAGCUGAAACCUGGGAAACAUCUAGAUAAUUUAAUUGAAAAUGAUUGACAUUCUCAAACAAAAAAGAAAAGAAAAUCAGAUACACCGCUUUCUUCUCUCCCUAUCUGCGGAGCCUGCCUCCUCCAACCUGCAUAGCUGCAUCCCAGUGCAUGUGCACCUGCCUGCUUGGACACUUCAAUGACUAACUUCUCUGCAAAUACAUCAAUAGUUUCAUUGCCUUCAGGCUUCUUCUAUGUCUUUUAACUCUUGAACCUUCUGGUGCAUUUUAGCUUACCAAACAGCACAUGCUGCUUUGUACUUGUGUUGUUUUAUGUAUUCAUUUAUUGCACAAAUUUUCCUUGAGUGCCUUGUUCAUGGAAGGCGCUAUUCCAGGAAUUUUAUGUGUAGUUUAAGUUACCUCCAUCUAAACUAUAAGAUUUUCAUAUAAUUCAUCUUUGUAGUUCUACCACAAGCAUAUUAGUAGAUUCUAAAUAAACGUUAACUCCAUAUUUGUGUGCAUGUAGAAAUAUGUCAUGUUUAUGUAUAUAUUAAUGCAUCUAUGUUUCUAUAUCUAACAAUGAUAAAAAAGUGCUAAUAAAAUGAUGAUUAACGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications