v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MME antisense RNA 1 (MME-AS1) URS0000811EB5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MME-AS1: MME-AS1 is a long non-coding RNA (lncRNA) that has been identified as a candidate biomarker for subtype classification and prognosis prediction in diffuse large B-cell lymphoma (DLBCL) [PMC7244244]. It is one of the 17 lncRNAs that make up a signature for subtype classification and prognosis prediction in DLBCL [PMC7244244]. Another study has reported that MME-AS1 is associated with prognosis in patients with intrahepatic cholangiocarcinoma [PMC8097183]. In DLBCL, other lncRNAs such as HOTAIR, PEG10, HULC, NONHSAG026900, lincRNA-p21, PANDA, and MALAT1 have also been found to be associated with prognosis and clinical features [PMC8097183] [PMC7244244] [PMC9170579] [PMC4904406] [PMC8863945]. A set of six lncRNAs including SACS-AS1, MME-AS1, CSMD2-AS1, RP11-360F5.1, RP11-25K19.1, and CTC-467M3.1 have been identified as being substantially correlated with the prognosis of DLBCL patients and can estimate overall survival beyond the conventional International Prognostic Index (IPI) system [PMC9170579]. These six-lncRNA signature can classify patients into high-risk or low-risk groups based on their expression levels of these lncRNAs. Patients in the low-risk group have better overall survival rates compared to those in the high-risk group [PMC9170579]. However, further studies are needed to understand the molecular function of these lncRNAs and other prognostic lncRNAs in DLBCL [PMC9170579] [PMC8863945].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUGAGAGAAGCAGAGGCCCAAAGGAAUAUUGCAAAUACCCAAGGUCACCCUGUCAGGAGUGGCAGAAUAGGGCUGGAACAAGGACUCUUUUCUCUGGACAGCUUGCACCUACAAUCCUUUCCAUCUUGCACCUACAAUCCACUCGAACACUGCAGCAUGGAGGCAGACUCCUUGCCAACGGGUAUUGUCGAGAGCUUCUUCCUACCAUCAUUUGAAGAAAAAAAGCUUGGAGAUGGGGAAGAAUGAUUGAUCAACAUGUUUCUUCCUUAGUUUGUUACUGCUGUUGUUUUAAAUCGAGAAAGCAUUUUUAAACAGGAUGGGGGGGGACUGAUAAUAUCAGUCCUCCUUAAUUUCAUUACAGCCGAGUCAUCAGUAUUUUAGUAUUUCUUGCAGGUUGAUGAUUACAACAAUAUAAUUUUAUUUAUUUUAAUUAAACUCUAUUUGCUUCCCACAUAAUUUGUGUUGACUCACAAGAAAAACAUGUAUGUGUAAACCCAGGGAUAUUAGACUAAAAUUGAGAGAUCAGAAACGAUGUAGAACAAAUAGAUUGCGUUGACGUGACUACGAAGUAUUAUAAAAGAAAAUAAACAAAAAUCAUGAUUAGGAAAUAUAUUAUGACUAUGUUUAUAUAUAUUCAGACAGUUACUAUAAUUCAGGUUCAGAUACGAUUCCAAGCUGUCUGGCAAGAAAGUCAAAAUGGAAAAUGUGCUCUUACUACUCCUAGGGGGAAACAUUGUUCCUUGCAUGACUUCUGAAAGGUAAUUCUGAUGUGUCCUCGACAUUUUCAUAGCAAACGUGGCAGCAAAUUUUUUAGGUAAACAGCUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications