v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2086 (LINC02086) URS0000811AA5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02086: LINC02086 is a long non-coding RNA (lncRNA) that has been found to play a role in various biological processes. It has been shown to promote the up-regulation of SLC26A2 by adsorbing miR-770-5p, thereby promoting the migration of larynx carcinoma cells [PMC8207764]. Interestingly, LINC02086 and LINC02575 have been found to be positively correlated with the overall survival of laryngeal squamous cell carcinoma (LSCC) patients [PMC8207764]. Dual-luciferase report analysis demonstrated that the activity of Dual-luciferase was significantly decreased in the wild-type LINC02086 and SLC26A2 groups after transfection with minic miR-770-5p [PMC8207764]. Additionally, a four-lncRNA prognosis model was extracted from the ceRNA network, which included LINC02086 as one of the prognostic markers [PMC8207764]. Furthermore, both LINC02086 and LINC02575 were found to promote cell migration and invasion in larynx carcinoma cells, while AC011933.2 and FAM30A inhibited these processes [PMC8207764]. The migration experiments also revealed that miR-770-5p could partially reverse the effect of LINC02086 on cell migration, while SLC26A2 could weaken the effect of miR-770-5p on cell migration [PMC8207764]. In another study, a risk scoring system based on lncRNA expression was developed for predicting overall survival in patients with cirrhosis. Higher expression levels of LINC02086 were associated with worse overall survival in this scoring system [PMC7568908]. Additionally, analysis of lung adenocarcinoma (LUAD) samples identified LINC02086 as one of the harmful and high-risk-related lncRNAs [PMC8637177].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CACAUAUGAGUUGGUUUUCCUUACUUAAAAUAUGCUUAUCAUCCCUUGGAGCACUUGAAAAUAUUGGCUAUUUCCUUCUGACCCCCAUGGUUUCUUUUAAAAAAUUUGCUGUUGUUUGAAUUAUUUUUCUCUACAGGUAUUGACUGCUGCCUCAUGAAGGCUGGUCCUGUCUCUAUAGUGAAUAUUGUGCACCUCAGGGUAGAAUGGAGAGCAGAAGACUUCAAAUCAGGCAGUCUGGGUUCAGACCCCAAUUCUAGUGCUAAAUAGCUACGUGACUUUAGGCCGAUUGUGUGUGACUUCCCUGAGCCCCAGUCUCUUUGCCUGCAAAAUGAGAAAAAUUAUAACAAUGUCAUCGGUUGUUCUGAGGAUUCUGAGAGGAAUUAGUAGGAGAGAGAACUAAGAAGCUGCGGGCCUCUACAGAGCCAUUCAACUGGCAUUUCGGAAGAUGUUGCCCAUCAGAGUCAGACCUUCUUAGCAUCUUCCGGCUGGGCCCAAACUUCCCAAGACCAUUUGGACAAGGUCAUCUCUAUCCCACCAUGGCCUCCUCCCAGAGGAGGAGAAGAAUCAUGCUGUUACAGCAGAACCGAAGAUUUGGGCAAGGGAGCUAAUGAUUAUGUUCUGCGUCAGGUCAGAGAUGGGCUGGGAAAGCCACUCCAAAGCCAAGACAAGCAGUUUCCUGGAAAAAGAAGGCUGCGCGGAGCCCAGAGUGGCCUGGAUCCUGCCUCAUUUCCUGGACCAGCUCCUUAGGUGGUUACUGGAUUGCCAAUAAAGCAGAGCUUAUUAAAGUCAACGAGCUCAGGCUUCAUCGCCGCCAUGGUAUCCAAGCACCAGUCUGUCUGGGAUUUCAUUUGCCAGAUGGACAAAGGAGAGGUUGUUCCAAUACAUAUCCUGAGUGGUGGGGGUGGGGAGAGAAGGGGAAGAAUGCUCUCUAGAGAAUUCUCUUUGUCCUCUGAAGUAAAUAGAGAUCAUGUCUUCCCCAGCCACACUCAGUGAUCUGAAUCUCUUGGACUGUGGAUUUUUCCUUUACCUGCUGUGAAGCCUUGAAAAGUAUGAAUUAGCUUGAUAAUGAUCCUCUAAAGAUGUUCAAGAGUUAAAGACGUGUUUAAGUUCUUCAGGCAAUCCAAUAUGACUACGGGUUUCCAAAAAUUUGAAGGAAACUGAAAAUCAUAGUUCCCAAACCAGAUAUUUUCCGGUGUCCAGAUGUUCACUGGCAUGCAAACCAAAUGUCUGGAUUAUGAGCUCCUUUUUUCAUUUCUUUUUAUCAGCUUACAUCCAGAUGUUGGAUCCAACUGGUCAGAGGCCUGGGGCAGAGACAGAAAUCAAAUCUAGGGUGUUCAUCUAGAGUCUCCUGCUCCUCCAUUCCUGCUUCCUCCUCACGCUGCCCCCACAUCCUCCCCAACUCACCUUCAUGCUACAUCUCGGCAAAUACAGCUCAUAUCCAGGCACGGUGCAGCCCUUGACAGCUGGGUCCGCAAAGGCAGAUCGGGUAUAUCUUUAAAGAAAAGUUAUCUUAACCAUUGAGAAGCCUUCCUUCCUCAGAGGAGAGCACCUCCCCAGCAGACCUCCGAGGAGACCAAGGGCAGGACAGGAAGGGUGAAAGGAAGUUUCAGGACUGCAGGAAAUAAGAGCUUGGAGGUCAAGGGAGAGAUCAGAUAAAACAUGAAUCUGAUCAGCAUCCUAGUGGUCUAGAGUGGAGACAAUCUGCGGAGUCAACCUCAGUAAGGACACACAUAGAGAAGAACCAAAGCCUCUAAAGACGAAGCUGAGAAGUGUACGGUCGUAGAAGACUCGUGUCUGUUAUUCUUAAAAGCUCAAGGAGAUGUUCUGCCAAUUGAAUGGAAACUGUCCAUAGUGGGGAGCAGAGAGCCUCAUCUUUUCUGGAACUGAACAUCCAUCCUUAAGGCCAGAUUUCUCCCAUCACCAACUUUAACUCCUGCCCUAGCCCUCUCUCUUCCUUUUCAAAACCCUCUCCACCCAGGAAGGGAGAUUCUGGAGCCAAGACUGUACCAGCCACACCUCCCCAGAGUUGUUAAGGAAGGAACUCGAAGCCAGGGGUGGUCUUCUGGCAAGCACCCCCACUACCAGUAGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications