Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) non-protein coding SCAANT1:3 URS00008119DC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

scaant1: SCAANT1, a long noncoding RNA (lncRNA), is transcribed antisense to the ATXN7 gene and is implicated in the regulation of Ataxin-7, a protein associated with spinocerebellar ataxia type 7 (SCA7), a neurodegenerative disorder [PMC3941653]. It functions as a repressor of Ataxin-7 transcription through epigenetic modifications and is dependent on the transcription factor CTCF [PMC3941653], [PMC7760973]. SCAANT1 expression leads to repressive epigenetic signals at the Ataxin-7 promoter and its loss results in de-repression of ataxin-7 transcription, chromatin remodeling, and an increase in ATXN7 mRNA levels [PMC7116994], [PMC3715420]. In SCA7 patients, lower levels of SCAANT1 correlate with longer CAG repeats within ATXN7, which are indicative of disease severity [PMC6416829]. The expression of SCAANT1 inversely correlates with SCA7 expression in patients, suggesting its potential as a therapeutic target to mitigate aberrant Ataxin-7 expression by overexpressing this antisense lncRNA [PMC7218086], [PMC3495748]. However, abnormal CAG repeat expansions can lead to inefficient formation of SCAANT1 and subsequent activation of ATXN7 transcription contributing to the development of SCA7 disease symptoms [PMC8058498].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGGACGAAGUACCGUGUGCACGCCACGCCGCCCACAUGUGUGCCCCCGACCCGCAAUUGGAAGUCACACUGUGCGCCUGGGGAACUUGAAUUCGUCCAGCAAAGAGAGAACAUGAGAUCAGUGUGCGAGGGAAUGGAGGAGAGUGAAACAAACCGAGAGAAGCUUUAACCCGUGUACAUAUUUUAGAGGCACCACCCCAAGUUUCUGGAAGUGAUUCAUUCACCCCAAAAGUAAAAAUCUGAUUCAUUUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications