v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1324 (LINC01324) URS00007E43E0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01324: LINC01324 is a long intervening/intergenic noncoding RNA that has been implicated in melanoma prognosis [PMC6794712]. It is part of a 6-lncRNA signature, along with AL050303, LINC00707, RP11-85G21, RP4-794I6.4, and RP5-855F16, that can predict the prognosis of melanoma patients [PMC6794712]. Among these signature lncRNAs, AL050303 and LINC00707 were found to be significantly elevated in the early-stage group compared to the advanced-stage group, while LINC01324, RP11-85G21, RP4-794I6.4 and RP5-855F16 were significantly lower in the early-stage group [PMC5843393]. LINC01324 has also been identified as a predictor for melanoma progression due to a missense variant SNP [PMC8530739]. Additionally, LINC01324 has been associated with estrogen metabolism along with other loci such as IGHV3-7 and RBBP8 [PMC8530739]. It is worth noting that lead SNPs at UGT3A1 and RBBP8 did not overlap with previous GWAS signals for LINC01324 [PMC8530739]. The six lncRNAs including LINC01324 have been shown to have an impact on MAPK pathways, immune and inflammatory responses, as well as focal adhesion pathways in patients with melanoma [PMC8557056]. Overall, these findings suggest that LINC01324 may play a significant role in melanoma prognosis and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCUACCUGAAUGCACUUGUGAACUUCAGAAUUUUGAAGCUCUGUCUCCUGACAUCACAGAUAGACAAGCACUGAACUUGGCAGGAAAAUCAGUAGGAGUAAGUGGCGGAGGCAUGGGACUGGCAGAGAUACGGCAGCCCCUGUGGAGAGGCUGUCUACAGAUAACAUAACAAUAACAACAGGAUCUGCGGGGUUCCUGCAUGCGUGUUGGCUUCACUGGAGAAACUAAUCAAGUGGUCUGAGUCAUUCAAGUUAUAGUCUAUUUGAAGACGAGUUGAAUCUGAAACAAUGAGUAAGAUGAUGAGAGCUCGAUACUUAUGGUUUAAAUAUAAAAGGGGUAUCCCAACUCAGAAAGAGAGAGGAGAUCUGGAAAAAUCCUGCUUUCUGAAGCUUUUGACGGUAUUUUCAUACUGCCUGACUAAAGUGCAACAGCUACAUAUUGACAGGCGGUGGAAGGUGCAGUUUGGACACAGAGACUGACACACAGGAAGAAUACCAUGUGAAGACUGGAGUUUUGCAUAGAGAAGCCAAGGAGCUACCAGAAGCUAGGAGAAUGGCCUGGAACAGACCUUUCCUUAGUGCCUUCAGAGAGAGCAUGGCGCUGCCAACAUCUUGAUCUCAGACUUCCAGCAUCCUGAAUUGUGAGAUAAAUUUCUGCUGUUUAAACCAUAUAAUUUGUGAUACUUUGCUAUGGCAACUGUCACAGCUAUUAUAAGCACCUAACCCUUUUUUUAAUCUUUUAAGAAACUUUUUGCUUUCAUCUACUUUUUUUGUUCUGGUUAUUCCAUAUUUUACUUUAAGAUUUAGUCUUCUGUCAAUAAAGCAAUAAUUUCAGAUCAAUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications